Incidental Mutation 'R9564:St5'
ID 721347
Institutional Source Beutler Lab
Gene Symbol St5
Ensembl Gene ENSMUSG00000031024
Gene Name suppression of tumorigenicity 5
Synonyms 2610305K15Rik, 2010004M01Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.607) question?
Stock # R9564 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 109523911-109703605 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 109526329 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 980 (D980E)
Ref Sequence ENSEMBL: ENSMUSP00000077067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000143107] [ENSMUST00000168005]
AlphaFold Q924W7
Predicted Effect probably damaging
Transcript: ENSMUST00000077909
AA Change: D980E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: D980E

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: D980E

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000084738
AA Change: D563E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024
AA Change: D563E

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143107
SMART Domains Protein: ENSMUSP00000123410
Gene: ENSMUSG00000046364

DomainStartEndE-ValueType
Pfam:Ribosomal_L18e 26 146 7.2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168005
AA Change: D563E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024
AA Change: D563E

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 135 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,057,305 N176K possibly damaging Het
3110009E18Rik T A 1: 120,169,276 V134E Het
9130409I23Rik G T 1: 181,055,245 V191F possibly damaging Het
Abca8a T A 11: 110,074,184 H429L probably benign Het
Acsf2 T A 11: 94,573,065 I98F possibly damaging Het
Actr5 A G 2: 158,628,215 D255G probably damaging Het
Adam21 C T 12: 81,559,059 C643Y probably damaging Het
Adcy7 TGG TG 8: 88,326,425 probably null Het
AI429214 A G 8: 36,993,913 S72G possibly damaging Het
Akap13 T C 7: 75,609,413 V595A probably benign Het
Akt3 T C 1: 177,080,203 T209A possibly damaging Het
Alpk2 C T 18: 65,305,943 G793D probably damaging Het
Amotl1 T C 9: 14,562,217 K562R possibly damaging Het
Ankib1 T A 5: 3,755,733 N178I possibly damaging Het
Arfgef1 A T 1: 10,147,533 D1560E probably benign Het
Arhgap20 AAGAGAG AAGAG 9: 51,850,113 probably null Het
Arpc5l A G 2: 39,015,112 T152A probably benign Het
Asic3 C G 5: 24,415,877 D252E possibly damaging Het
Atf7 T A 15: 102,534,277 M466L probably benign Het
Bcl9l A G 9: 44,509,257 D1320G probably damaging Het
Bdkrb1 G A 12: 105,604,819 V215I probably benign Het
Brpf3 T G 17: 28,807,178 D408E probably benign Het
Btn2a2 C A 13: 23,478,678 K367N possibly damaging Het
Btnl10 T A 11: 58,922,363 F273I probably benign Het
C1qtnf12 C T 4: 155,965,016 T145I probably benign Het
Cacna1s T C 1: 136,118,778 C1763R probably benign Het
Ccdc154 C A 17: 25,168,407 Q372K possibly damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Celsr2 T C 3: 108,414,518 Y326C probably damaging Het
Cfap46 A T 7: 139,651,555 V914E Het
Coil T A 11: 88,981,800 V329E possibly damaging Het
Copb1 A G 7: 114,236,799 I449T possibly damaging Het
Copg1 T G 6: 87,892,701 S187R probably damaging Het
Cps1 T A 1: 67,158,889 F371Y probably benign Het
Cpt1b A T 15: 89,419,269 F554L probably damaging Het
Ctdsp2 A G 10: 126,996,171 D216G probably damaging Het
Ctla2b A T 13: 60,896,042 Y104* probably null Het
Cyp2j6 A G 4: 96,526,008 I340T probably damaging Het
Ddi1 T A 9: 6,265,730 D213V probably damaging Het
Dlgap1 T G 17: 70,657,463 N400K probably benign Het
Dnah5 G A 15: 28,290,276 V1271M probably benign Het
Dnah8 T A 17: 30,713,047 V1463E probably benign Het
Dstyk G A 1: 132,434,285 R151H probably damaging Het
Ehd3 T G 17: 73,830,366 V510G probably benign Het
Enthd1 G T 15: 80,560,034 Q107K probably damaging Het
Entpd7 A G 19: 43,717,450 E237G probably benign Het
Fadd A T 7: 144,582,311 C27S probably damaging Het
Fan1 A G 7: 64,349,492 L874P possibly damaging Het
Fbxw17 T C 13: 50,425,569 W141R probably damaging Het
Fig4 A G 10: 41,285,391 V63A probably benign Het
Fmo3 T C 1: 162,958,452 D323G probably damaging Het
Gas8 T A 8: 123,536,440 V452E possibly damaging Het
Gdf9 T A 11: 53,436,684 S156T probably damaging Het
Gm15922 C T 7: 3,739,647 V21M possibly damaging Het
Gm884 T C 11: 103,612,996 I2715M unknown Het
Hlcs T C 16: 94,134,721 S571G probably benign Het
Hmox2 A G 16: 4,765,006 Y201C probably damaging Het
Ikzf3 T A 11: 98,467,206 D435V probably damaging Het
Kank2 T C 9: 21,794,556 T389A possibly damaging Het
Kank2 A G 9: 21,795,335 L129P probably damaging Het
Kdr T A 5: 75,964,905 K339N probably benign Het
Lmntd2 A G 7: 141,210,788 S516P Het
Lrrc40 T A 3: 158,040,441 V51D probably benign Het
Lrrtm1 A G 6: 77,244,553 N331S probably benign Het
Lvrn T G 18: 46,884,439 I612S probably damaging Het
Map3k3 T A 11: 106,151,034 I413N probably damaging Het
Mcm9 C T 10: 53,630,008 A57T possibly damaging Het
Met T A 6: 17,531,426 F568I probably benign Het
Mkx A G 18: 7,002,457 F30L probably benign Het
Mrc1 A G 2: 14,261,306 N345S probably benign Het
Mstn T A 1: 53,064,208 N234K probably benign Het
Mtmr3 A T 11: 4,490,992 S554T possibly damaging Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Myh8 T C 11: 67,286,389 V427A probably benign Het
Nr4a2 A T 2: 57,110,178 I365N probably damaging Het
Nrxn2 A G 19: 6,509,857 D1215G probably damaging Het
Olfr709-ps1 A G 7: 106,926,640 M273T probably benign Het
Olfr820 T C 10: 130,017,418 I19T probably benign Het
Olfr830 G A 9: 18,875,344 V3I probably benign Het
Osbpl6 T A 2: 76,595,977 W967R probably damaging Het
Pcdhb21 T C 18: 37,513,919 S34P possibly damaging Het
Pibf1 G T 14: 99,137,174 D350Y possibly damaging Het
Plekhs1 A T 19: 56,473,196 I123F probably damaging Het
Pold2 C T 11: 5,874,163 G214D probably benign Het
Pomc A G 12: 3,959,971 T71A probably benign Het
Pot1b A G 17: 55,662,465 S568P possibly damaging Het
Prkd2 C A 7: 16,857,819 Q592K possibly damaging Het
Prss28 C T 17: 25,309,937 A84V probably damaging Het
Prtg T A 9: 72,858,871 Y649N probably damaging Het
Psip1 T C 4: 83,468,651 E161G possibly damaging Het
Rab3gap2 A G 1: 185,282,494 D1280G probably damaging Het
Rab3ip A T 10: 116,915,875 I329N probably damaging Het
Rarres2 C T 6: 48,572,230 G13D possibly damaging Het
Rbp3 A G 14: 33,955,520 D475G probably damaging Het
Ric3 A G 7: 109,038,811 V246A probably damaging Het
Robo3 A G 9: 37,429,604 F124S probably damaging Het
Rpl27a C A 7: 109,519,630 H17N probably benign Het
Rptn A G 3: 93,397,229 D623G probably benign Het
Rtl1 G T 12: 109,590,279 Q1709K probably benign Het
Sacs T A 14: 61,211,597 D3697E probably damaging Het
Sec61b A G 4: 47,483,049 Y93C probably damaging Het
Serpina3a A T 12: 104,118,627 I94L probably benign Het
Skiv2l C T 17: 34,844,782 A562T probably benign Het
Skor2 C T 18: 76,858,681 H33Y unknown Het
Slc12a3 G A 8: 94,356,355 V874I probably benign Het
Slit1 T A 19: 41,603,422 M1254L probably benign Het
Smg1 A G 7: 118,212,985 S52P unknown Het
Sorl1 A G 9: 42,046,597 Y584H probably damaging Het
Spata32 T A 11: 103,208,953 Q242L possibly damaging Het
Sptbn4 T G 7: 27,418,079 E415A probably damaging Het
St6galnac5 T C 3: 152,840,145 R259G probably damaging Het
Stat3 T C 11: 100,893,788 I589V probably benign Het
Tecta T A 9: 42,337,827 K1913M probably damaging Het
Tek C A 4: 94,873,935 N1103K probably damaging Het
Telo2 A G 17: 25,115,225 I16T probably benign Het
Tmem207 G T 16: 26,516,749 C79* probably null Het
Topaz1 C T 9: 122,750,154 H710Y probably benign Het
Trim33 T A 3: 103,331,649 S648T probably benign Het
Trpm6 A G 19: 18,873,876 T1734A possibly damaging Het
Trpm8 A G 1: 88,326,436 E127G possibly damaging Het
Ttc3 T A 16: 94,448,059 C1139S probably benign Het
Ttn T C 2: 76,749,986 E23521G probably damaging Het
Ush2a T C 1: 188,536,354 I1669T possibly damaging Het
Vcpip1 C A 1: 9,747,231 S309I possibly damaging Het
Vmn1r208 A G 13: 22,772,619 V236A probably damaging Het
Vmn1r74 T C 7: 11,847,607 F278S probably damaging Het
Vmn2r33 T C 7: 7,554,082 S540G probably benign Het
Vmn2r52 T C 7: 10,171,255 D219G probably benign Het
Wiz G T 17: 32,356,965 D812E probably benign Het
Ylpm1 C T 12: 85,044,402 P1787S probably benign Het
Zan T C 5: 137,406,426 E3858G unknown Het
Zfp760 T G 17: 21,723,291 H482Q possibly damaging Het
Zfp78 A G 7: 6,378,391 T147A probably benign Het
Zfp808 T A 13: 62,172,847 I630K possibly damaging Het
Zpld1 T A 16: 55,241,338 R227* probably null Het
Other mutations in St5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:St5 APN 7 109527708 missense possibly damaging 0.71
IGL01132:St5 APN 7 109570005 splice site probably null
IGL01288:St5 APN 7 109539822 missense probably damaging 0.96
IGL01645:St5 APN 7 109527634 nonsense probably null
IGL01714:St5 APN 7 109570062 missense probably damaging 0.99
IGL02021:St5 APN 7 109557372 missense probably damaging 1.00
IGL02302:St5 APN 7 109525331 missense probably damaging 1.00
IGL02496:St5 APN 7 109556235 missense possibly damaging 0.83
IGL02795:St5 APN 7 109556364 missense probably damaging 1.00
Bucolic UTSW 7 109525548 nonsense probably null
Halcyon UTSW 7 109556793 nonsense probably null
FR4340:St5 UTSW 7 109556921 unclassified probably benign
FR4737:St5 UTSW 7 109556921 unclassified probably benign
PIT4466001:St5 UTSW 7 109531130 missense probably damaging 1.00
PIT4469001:St5 UTSW 7 109531130 missense probably damaging 1.00
PIT4472001:St5 UTSW 7 109531130 missense probably damaging 1.00
R0024:St5 UTSW 7 109524659 missense probably damaging 1.00
R0124:St5 UTSW 7 109542511 missense possibly damaging 0.66
R0125:St5 UTSW 7 109556338 missense probably benign 0.19
R0365:St5 UTSW 7 109538949 missense probably damaging 1.00
R0491:St5 UTSW 7 109557204 missense probably benign 0.45
R0534:St5 UTSW 7 109541428 missense probably damaging 1.00
R0662:St5 UTSW 7 109557426 missense probably damaging 1.00
R0743:St5 UTSW 7 109557345 missense probably damaging 1.00
R0772:St5 UTSW 7 109542320 splice site probably null
R0774:St5 UTSW 7 109542320 splice site probably null
R0787:St5 UTSW 7 109525620 missense possibly damaging 0.94
R0884:St5 UTSW 7 109557345 missense probably damaging 1.00
R1518:St5 UTSW 7 109557355 missense probably damaging 1.00
R1908:St5 UTSW 7 109525326 nonsense probably null
R1909:St5 UTSW 7 109525326 nonsense probably null
R2232:St5 UTSW 7 109557207 missense probably benign
R2358:St5 UTSW 7 109556446 missense probably benign 0.01
R2847:St5 UTSW 7 109525337 missense probably damaging 1.00
R2869:St5 UTSW 7 109557430 missense probably benign 0.01
R2869:St5 UTSW 7 109557430 missense probably benign 0.01
R2870:St5 UTSW 7 109557430 missense probably benign 0.01
R2870:St5 UTSW 7 109557430 missense probably benign 0.01
R2871:St5 UTSW 7 109557430 missense probably benign 0.01
R2871:St5 UTSW 7 109557430 missense probably benign 0.01
R2873:St5 UTSW 7 109557430 missense probably benign 0.01
R2874:St5 UTSW 7 109557430 missense probably benign 0.01
R4534:St5 UTSW 7 109531156 missense probably damaging 1.00
R4536:St5 UTSW 7 109531156 missense probably damaging 1.00
R4559:St5 UTSW 7 109525578 missense probably damaging 1.00
R4798:St5 UTSW 7 109557033 missense probably damaging 0.99
R4846:St5 UTSW 7 109556836 nonsense probably null
R5110:St5 UTSW 7 109542490 missense probably benign 0.02
R5181:St5 UTSW 7 109556790 missense probably benign
R5268:St5 UTSW 7 109557312 missense probably benign
R5403:St5 UTSW 7 109556905 missense probably damaging 1.00
R5836:St5 UTSW 7 109541345 missense possibly damaging 0.78
R5932:St5 UTSW 7 109570016 missense probably damaging 1.00
R5937:St5 UTSW 7 109557271 missense possibly damaging 0.86
R6180:St5 UTSW 7 109556888 missense probably benign 0.11
R6741:St5 UTSW 7 109545097 missense possibly damaging 0.95
R6781:St5 UTSW 7 109525304 missense possibly damaging 0.83
R7086:St5 UTSW 7 109525574 missense probably damaging 1.00
R7466:St5 UTSW 7 109525346 missense probably damaging 1.00
R7644:St5 UTSW 7 109556793 nonsense probably null
R8354:St5 UTSW 7 109525548 nonsense probably null
R8745:St5 UTSW 7 109557072 missense probably benign 0.02
R8859:St5 UTSW 7 109524656 missense probably damaging 1.00
R9016:St5 UTSW 7 109540435 missense possibly damaging 0.84
R9178:St5 UTSW 7 109557084 missense probably benign 0.31
R9361:St5 UTSW 7 109527784 missense probably damaging 1.00
R9595:St5 UTSW 7 109556766 missense probably damaging 0.96
RF062:St5 UTSW 7 109556946 unclassified probably benign
X0067:St5 UTSW 7 109556240 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGTGACCCAGTTCCTACAC -3'
(R):5'- GCATGGGTCCAAAGAATCAGC -3'

Sequencing Primer
(F):5'- GTGACCCAGTTCCTACACCTAGG -3'
(R):5'- GGGTCCAAAGAATCAGCTGCTC -3'
Posted On 2022-08-09