Incidental Mutation 'R9564:Rab3ip'
ID 721371
Institutional Source Beutler Lab
Gene Symbol Rab3ip
Ensembl Gene ENSMUSG00000064181
Gene Name RAB3A interacting protein
Synonyms Rabin3, Gtpat12, SSX2 interacting protein
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9564 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 116905784-116950769 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 116915875 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 329 (I329N)
Ref Sequence ENSEMBL: ENSMUSP00000151708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020375] [ENSMUST00000219109]
AlphaFold Q68EF0
Predicted Effect probably damaging
Transcript: ENSMUST00000020375
AA Change: I297N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020375
Gene: ENSMUSG00000064181
AA Change: I297N

DomainStartEndE-ValueType
low complexity region 84 100 N/A INTRINSIC
PDB:4LHZ|F 157 200 9e-15 PDB
low complexity region 213 220 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219109
AA Change: I329N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are fertile and show no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 135 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,057,305 N176K possibly damaging Het
3110009E18Rik T A 1: 120,169,276 V134E Het
9130409I23Rik G T 1: 181,055,245 V191F possibly damaging Het
Abca8a T A 11: 110,074,184 H429L probably benign Het
Acsf2 T A 11: 94,573,065 I98F possibly damaging Het
Actr5 A G 2: 158,628,215 D255G probably damaging Het
Adam21 C T 12: 81,559,059 C643Y probably damaging Het
Adcy7 TGG TG 8: 88,326,425 probably null Het
AI429214 A G 8: 36,993,913 S72G possibly damaging Het
Akap13 T C 7: 75,609,413 V595A probably benign Het
Akt3 T C 1: 177,080,203 T209A possibly damaging Het
Alpk2 C T 18: 65,305,943 G793D probably damaging Het
Amotl1 T C 9: 14,562,217 K562R possibly damaging Het
Ankib1 T A 5: 3,755,733 N178I possibly damaging Het
Arfgef1 A T 1: 10,147,533 D1560E probably benign Het
Arhgap20 AAGAGAG AAGAG 9: 51,850,113 probably null Het
Arpc5l A G 2: 39,015,112 T152A probably benign Het
Asic3 C G 5: 24,415,877 D252E possibly damaging Het
Atf7 T A 15: 102,534,277 M466L probably benign Het
Bcl9l A G 9: 44,509,257 D1320G probably damaging Het
Bdkrb1 G A 12: 105,604,819 V215I probably benign Het
Brpf3 T G 17: 28,807,178 D408E probably benign Het
Btn2a2 C A 13: 23,478,678 K367N possibly damaging Het
Btnl10 T A 11: 58,922,363 F273I probably benign Het
C1qtnf12 C T 4: 155,965,016 T145I probably benign Het
Cacna1s T C 1: 136,118,778 C1763R probably benign Het
Ccdc154 C A 17: 25,168,407 Q372K possibly damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Celsr2 T C 3: 108,414,518 Y326C probably damaging Het
Cfap46 A T 7: 139,651,555 V914E Het
Coil T A 11: 88,981,800 V329E possibly damaging Het
Copb1 A G 7: 114,236,799 I449T possibly damaging Het
Copg1 T G 6: 87,892,701 S187R probably damaging Het
Cps1 T A 1: 67,158,889 F371Y probably benign Het
Cpt1b A T 15: 89,419,269 F554L probably damaging Het
Ctdsp2 A G 10: 126,996,171 D216G probably damaging Het
Ctla2b A T 13: 60,896,042 Y104* probably null Het
Cyp2j6 A G 4: 96,526,008 I340T probably damaging Het
Ddi1 T A 9: 6,265,730 D213V probably damaging Het
Dlgap1 T G 17: 70,657,463 N400K probably benign Het
Dnah5 G A 15: 28,290,276 V1271M probably benign Het
Dnah8 T A 17: 30,713,047 V1463E probably benign Het
Dstyk G A 1: 132,434,285 R151H probably damaging Het
Ehd3 T G 17: 73,830,366 V510G probably benign Het
Enthd1 G T 15: 80,560,034 Q107K probably damaging Het
Entpd7 A G 19: 43,717,450 E237G probably benign Het
Fadd A T 7: 144,582,311 C27S probably damaging Het
Fan1 A G 7: 64,349,492 L874P possibly damaging Het
Fbxw17 T C 13: 50,425,569 W141R probably damaging Het
Fig4 A G 10: 41,285,391 V63A probably benign Het
Fmo3 T C 1: 162,958,452 D323G probably damaging Het
Gas8 T A 8: 123,536,440 V452E possibly damaging Het
Gdf9 T A 11: 53,436,684 S156T probably damaging Het
Gm15922 C T 7: 3,739,647 V21M possibly damaging Het
Gm884 T C 11: 103,612,996 I2715M unknown Het
Hlcs T C 16: 94,134,721 S571G probably benign Het
Hmox2 A G 16: 4,765,006 Y201C probably damaging Het
Ikzf3 T A 11: 98,467,206 D435V probably damaging Het
Kank2 T C 9: 21,794,556 T389A possibly damaging Het
Kank2 A G 9: 21,795,335 L129P probably damaging Het
Kdr T A 5: 75,964,905 K339N probably benign Het
Lmntd2 A G 7: 141,210,788 S516P Het
Lrrc40 T A 3: 158,040,441 V51D probably benign Het
Lrrtm1 A G 6: 77,244,553 N331S probably benign Het
Lvrn T G 18: 46,884,439 I612S probably damaging Het
Map3k3 T A 11: 106,151,034 I413N probably damaging Het
Mcm9 C T 10: 53,630,008 A57T possibly damaging Het
Met T A 6: 17,531,426 F568I probably benign Het
Mkx A G 18: 7,002,457 F30L probably benign Het
Mrc1 A G 2: 14,261,306 N345S probably benign Het
Mstn T A 1: 53,064,208 N234K probably benign Het
Mtmr3 A T 11: 4,490,992 S554T possibly damaging Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Myh8 T C 11: 67,286,389 V427A probably benign Het
Nr4a2 A T 2: 57,110,178 I365N probably damaging Het
Nrxn2 A G 19: 6,509,857 D1215G probably damaging Het
Olfr709-ps1 A G 7: 106,926,640 M273T probably benign Het
Olfr820 T C 10: 130,017,418 I19T probably benign Het
Olfr830 G A 9: 18,875,344 V3I probably benign Het
Osbpl6 T A 2: 76,595,977 W967R probably damaging Het
Pcdhb21 T C 18: 37,513,919 S34P possibly damaging Het
Pibf1 G T 14: 99,137,174 D350Y possibly damaging Het
Plekhs1 A T 19: 56,473,196 I123F probably damaging Het
Pold2 C T 11: 5,874,163 G214D probably benign Het
Pomc A G 12: 3,959,971 T71A probably benign Het
Pot1b A G 17: 55,662,465 S568P possibly damaging Het
Prkd2 C A 7: 16,857,819 Q592K possibly damaging Het
Prss28 C T 17: 25,309,937 A84V probably damaging Het
Prtg T A 9: 72,858,871 Y649N probably damaging Het
Psip1 T C 4: 83,468,651 E161G possibly damaging Het
Rab3gap2 A G 1: 185,282,494 D1280G probably damaging Het
Rarres2 C T 6: 48,572,230 G13D possibly damaging Het
Rbp3 A G 14: 33,955,520 D475G probably damaging Het
Ric3 A G 7: 109,038,811 V246A probably damaging Het
Robo3 A G 9: 37,429,604 F124S probably damaging Het
Rpl27a C A 7: 109,519,630 H17N probably benign Het
Rptn A G 3: 93,397,229 D623G probably benign Het
Rtl1 G T 12: 109,590,279 Q1709K probably benign Het
Sacs T A 14: 61,211,597 D3697E probably damaging Het
Sec61b A G 4: 47,483,049 Y93C probably damaging Het
Serpina3a A T 12: 104,118,627 I94L probably benign Het
Skiv2l C T 17: 34,844,782 A562T probably benign Het
Skor2 C T 18: 76,858,681 H33Y unknown Het
Slc12a3 G A 8: 94,356,355 V874I probably benign Het
Slit1 T A 19: 41,603,422 M1254L probably benign Het
Smg1 A G 7: 118,212,985 S52P unknown Het
Sorl1 A G 9: 42,046,597 Y584H probably damaging Het
Spata32 T A 11: 103,208,953 Q242L possibly damaging Het
Sptbn4 T G 7: 27,418,079 E415A probably damaging Het
St5 G T 7: 109,526,329 D980E probably damaging Het
St6galnac5 T C 3: 152,840,145 R259G probably damaging Het
Stat3 T C 11: 100,893,788 I589V probably benign Het
Tecta T A 9: 42,337,827 K1913M probably damaging Het
Tek C A 4: 94,873,935 N1103K probably damaging Het
Telo2 A G 17: 25,115,225 I16T probably benign Het
Tmem207 G T 16: 26,516,749 C79* probably null Het
Topaz1 C T 9: 122,750,154 H710Y probably benign Het
Trim33 T A 3: 103,331,649 S648T probably benign Het
Trpm6 A G 19: 18,873,876 T1734A possibly damaging Het
Trpm8 A G 1: 88,326,436 E127G possibly damaging Het
Ttc3 T A 16: 94,448,059 C1139S probably benign Het
Ttn T C 2: 76,749,986 E23521G probably damaging Het
Ush2a T C 1: 188,536,354 I1669T possibly damaging Het
Vcpip1 C A 1: 9,747,231 S309I possibly damaging Het
Vmn1r208 A G 13: 22,772,619 V236A probably damaging Het
Vmn1r74 T C 7: 11,847,607 F278S probably damaging Het
Vmn2r33 T C 7: 7,554,082 S540G probably benign Het
Vmn2r52 T C 7: 10,171,255 D219G probably benign Het
Wiz G T 17: 32,356,965 D812E probably benign Het
Ylpm1 C T 12: 85,044,402 P1787S probably benign Het
Zan T C 5: 137,406,426 E3858G unknown Het
Zfp760 T G 17: 21,723,291 H482Q possibly damaging Het
Zfp78 A G 7: 6,378,391 T147A probably benign Het
Zfp808 T A 13: 62,172,847 I630K possibly damaging Het
Zpld1 T A 16: 55,241,338 R227* probably null Het
Other mutations in Rab3ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01912:Rab3ip APN 10 116907092 missense probably benign 0.09
IGL01946:Rab3ip APN 10 116937395 critical splice donor site probably null
IGL02665:Rab3ip APN 10 116937548 missense probably benign 0.02
R1538:Rab3ip UTSW 10 116939254 missense probably damaging 1.00
R1565:Rab3ip UTSW 10 116939223 missense probably benign 0.09
R1760:Rab3ip UTSW 10 116937510 missense probably damaging 1.00
R2077:Rab3ip UTSW 10 116918960 missense possibly damaging 0.87
R4441:Rab3ip UTSW 10 116915932 missense probably benign 0.19
R5442:Rab3ip UTSW 10 116918848 missense probably benign
R5526:Rab3ip UTSW 10 116918929 missense possibly damaging 0.61
R5682:Rab3ip UTSW 10 116907103 nonsense probably null
R5921:Rab3ip UTSW 10 116939247 missense probably damaging 1.00
R6254:Rab3ip UTSW 10 116915867 missense probably damaging 1.00
R7021:Rab3ip UTSW 10 116939378 missense probably damaging 1.00
R7026:Rab3ip UTSW 10 116937536 missense probably benign 0.18
R7326:Rab3ip UTSW 10 116937633 missense probably benign 0.07
R7408:Rab3ip UTSW 10 116937641 missense possibly damaging 0.62
R7655:Rab3ip UTSW 10 116914139 missense probably benign 0.04
R7656:Rab3ip UTSW 10 116914139 missense probably benign 0.04
R8363:Rab3ip UTSW 10 116918964 missense probably damaging 1.00
R8537:Rab3ip UTSW 10 116910154 missense probably damaging 1.00
R9085:Rab3ip UTSW 10 116939405 missense probably damaging 1.00
R9086:Rab3ip UTSW 10 116939405 missense probably damaging 1.00
R9161:Rab3ip UTSW 10 116914161 missense probably damaging 1.00
R9451:Rab3ip UTSW 10 116939449 start codon destroyed probably null 0.97
R9563:Rab3ip UTSW 10 116918763 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CCGTGATCGTGGTCCTAATG -3'
(R):5'- CCACTCTCTAGAGGAAGATTGC -3'

Sequencing Primer
(F):5'- CGTGATCGTGGTCCTAATGGAAAATG -3'
(R):5'- CTCTAGAGGAAGATTGCTATCATGG -3'
Posted On 2022-08-09