Incidental Mutation 'R9564:Dnah5'
ID 721403
Institutional Source Beutler Lab
Gene Symbol Dnah5
Ensembl Gene ENSMUSG00000022262
Gene Name dynein, axonemal, heavy chain 5
Synonyms b2b1565Clo, b2b1134Clo, Mdnah5, b2b1537Clo, b2b1154Clo, Dnahc5
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_133365.3; MGI: 107718

Essential gene? Possibly essential (E-score: 0.682) question?
Stock # R9564 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 28203752-28472052 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 28290276 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 1271 (V1271M)
Ref Sequence ENSEMBL: ENSMUSP00000069751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067048]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000067048
AA Change: V1271M

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000069751
Gene: ENSMUSG00000022262
AA Change: V1271M

DomainStartEndE-ValueType
Pfam:DHC_N1 247 802 2.3e-163 PFAM
low complexity region 1077 1088 N/A INTRINSIC
low complexity region 1113 1128 N/A INTRINSIC
Pfam:DHC_N2 1399 1807 2.3e-134 PFAM
AAA 1972 2108 2e-3 SMART
AAA 2251 2424 4.3e-3 SMART
AAA 2579 2777 2.2e-3 SMART
low complexity region 2874 2889 N/A INTRINSIC
Pfam:AAA_8 2914 3186 3.2e-70 PFAM
Pfam:MT 3198 3546 1e-44 PFAM
Pfam:AAA_9 3567 3792 1.4e-86 PFAM
low complexity region 3889 3899 N/A INTRINSIC
Pfam:Dynein_heavy 3930 4618 4.4e-246 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype Strain: 2180081
Lethality: D14-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dynein protein, which is part of a microtubule-associated motor protein complex consisting of heavy, light, and intermediate chains. This protein is an axonemal heavy chain dynein. It functions as a force-generating protein with ATPase activity, whereby the release of ADP is thought to produce the force-producing power stroke. Mutations in this gene cause primary ciliary dyskinesia type 3, as well as Kartagener syndrome, which are both diseases due to ciliary defects. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display postnatal lethality, hydrocephalus, respiratory infections, situs inversus and ciliary immotility. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(2) Gene trapped(1) Transgenic(1) Chemically induced(7)

Other mutations in this stock
Total: 135 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,057,305 N176K possibly damaging Het
3110009E18Rik T A 1: 120,169,276 V134E Het
9130409I23Rik G T 1: 181,055,245 V191F possibly damaging Het
Abca8a T A 11: 110,074,184 H429L probably benign Het
Acsf2 T A 11: 94,573,065 I98F possibly damaging Het
Actr5 A G 2: 158,628,215 D255G probably damaging Het
Adam21 C T 12: 81,559,059 C643Y probably damaging Het
Adcy7 TGG TG 8: 88,326,425 probably null Het
AI429214 A G 8: 36,993,913 S72G possibly damaging Het
Akap13 T C 7: 75,609,413 V595A probably benign Het
Akt3 T C 1: 177,080,203 T209A possibly damaging Het
Alpk2 C T 18: 65,305,943 G793D probably damaging Het
Amotl1 T C 9: 14,562,217 K562R possibly damaging Het
Ankib1 T A 5: 3,755,733 N178I possibly damaging Het
Arfgef1 A T 1: 10,147,533 D1560E probably benign Het
Arhgap20 AAGAGAG AAGAG 9: 51,850,113 probably null Het
Arpc5l A G 2: 39,015,112 T152A probably benign Het
Asic3 C G 5: 24,415,877 D252E possibly damaging Het
Atf7 T A 15: 102,534,277 M466L probably benign Het
Bcl9l A G 9: 44,509,257 D1320G probably damaging Het
Bdkrb1 G A 12: 105,604,819 V215I probably benign Het
Brpf3 T G 17: 28,807,178 D408E probably benign Het
Btn2a2 C A 13: 23,478,678 K367N possibly damaging Het
Btnl10 T A 11: 58,922,363 F273I probably benign Het
C1qtnf12 C T 4: 155,965,016 T145I probably benign Het
Cacna1s T C 1: 136,118,778 C1763R probably benign Het
Ccdc154 C A 17: 25,168,407 Q372K possibly damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Celsr2 T C 3: 108,414,518 Y326C probably damaging Het
Cfap46 A T 7: 139,651,555 V914E Het
Coil T A 11: 88,981,800 V329E possibly damaging Het
Copb1 A G 7: 114,236,799 I449T possibly damaging Het
Copg1 T G 6: 87,892,701 S187R probably damaging Het
Cps1 T A 1: 67,158,889 F371Y probably benign Het
Cpt1b A T 15: 89,419,269 F554L probably damaging Het
Ctdsp2 A G 10: 126,996,171 D216G probably damaging Het
Ctla2b A T 13: 60,896,042 Y104* probably null Het
Cyp2j6 A G 4: 96,526,008 I340T probably damaging Het
Ddi1 T A 9: 6,265,730 D213V probably damaging Het
Dlgap1 T G 17: 70,657,463 N400K probably benign Het
Dnah8 T A 17: 30,713,047 V1463E probably benign Het
Dstyk G A 1: 132,434,285 R151H probably damaging Het
Ehd3 T G 17: 73,830,366 V510G probably benign Het
Enthd1 G T 15: 80,560,034 Q107K probably damaging Het
Entpd7 A G 19: 43,717,450 E237G probably benign Het
Fadd A T 7: 144,582,311 C27S probably damaging Het
Fan1 A G 7: 64,349,492 L874P possibly damaging Het
Fbxw17 T C 13: 50,425,569 W141R probably damaging Het
Fig4 A G 10: 41,285,391 V63A probably benign Het
Fmo3 T C 1: 162,958,452 D323G probably damaging Het
Gas8 T A 8: 123,536,440 V452E possibly damaging Het
Gdf9 T A 11: 53,436,684 S156T probably damaging Het
Gm15922 C T 7: 3,739,647 V21M possibly damaging Het
Gm884 T C 11: 103,612,996 I2715M unknown Het
Hlcs T C 16: 94,134,721 S571G probably benign Het
Hmox2 A G 16: 4,765,006 Y201C probably damaging Het
Ikzf3 T A 11: 98,467,206 D435V probably damaging Het
Kank2 T C 9: 21,794,556 T389A possibly damaging Het
Kank2 A G 9: 21,795,335 L129P probably damaging Het
Kdr T A 5: 75,964,905 K339N probably benign Het
Lmntd2 A G 7: 141,210,788 S516P Het
Lrrc40 T A 3: 158,040,441 V51D probably benign Het
Lrrtm1 A G 6: 77,244,553 N331S probably benign Het
Lvrn T G 18: 46,884,439 I612S probably damaging Het
Map3k3 T A 11: 106,151,034 I413N probably damaging Het
Mcm9 C T 10: 53,630,008 A57T possibly damaging Het
Met T A 6: 17,531,426 F568I probably benign Het
Mkx A G 18: 7,002,457 F30L probably benign Het
Mrc1 A G 2: 14,261,306 N345S probably benign Het
Mstn T A 1: 53,064,208 N234K probably benign Het
Mtmr3 A T 11: 4,490,992 S554T possibly damaging Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Myh8 T C 11: 67,286,389 V427A probably benign Het
Nr4a2 A T 2: 57,110,178 I365N probably damaging Het
Nrxn2 A G 19: 6,509,857 D1215G probably damaging Het
Olfr709-ps1 A G 7: 106,926,640 M273T probably benign Het
Olfr820 T C 10: 130,017,418 I19T probably benign Het
Olfr830 G A 9: 18,875,344 V3I probably benign Het
Osbpl6 T A 2: 76,595,977 W967R probably damaging Het
Pcdhb21 T C 18: 37,513,919 S34P possibly damaging Het
Pibf1 G T 14: 99,137,174 D350Y possibly damaging Het
Plekhs1 A T 19: 56,473,196 I123F probably damaging Het
Pold2 C T 11: 5,874,163 G214D probably benign Het
Pomc A G 12: 3,959,971 T71A probably benign Het
Pot1b A G 17: 55,662,465 S568P possibly damaging Het
Prkd2 C A 7: 16,857,819 Q592K possibly damaging Het
Prss28 C T 17: 25,309,937 A84V probably damaging Het
Prtg T A 9: 72,858,871 Y649N probably damaging Het
Psip1 T C 4: 83,468,651 E161G possibly damaging Het
Rab3gap2 A G 1: 185,282,494 D1280G probably damaging Het
Rab3ip A T 10: 116,915,875 I329N probably damaging Het
Rarres2 C T 6: 48,572,230 G13D possibly damaging Het
Rbp3 A G 14: 33,955,520 D475G probably damaging Het
Ric3 A G 7: 109,038,811 V246A probably damaging Het
Robo3 A G 9: 37,429,604 F124S probably damaging Het
Rpl27a C A 7: 109,519,630 H17N probably benign Het
Rptn A G 3: 93,397,229 D623G probably benign Het
Rtl1 G T 12: 109,590,279 Q1709K probably benign Het
Sacs T A 14: 61,211,597 D3697E probably damaging Het
Sec61b A G 4: 47,483,049 Y93C probably damaging Het
Serpina3a A T 12: 104,118,627 I94L probably benign Het
Skiv2l C T 17: 34,844,782 A562T probably benign Het
Skor2 C T 18: 76,858,681 H33Y unknown Het
Slc12a3 G A 8: 94,356,355 V874I probably benign Het
Slit1 T A 19: 41,603,422 M1254L probably benign Het
Smg1 A G 7: 118,212,985 S52P unknown Het
Sorl1 A G 9: 42,046,597 Y584H probably damaging Het
Spata32 T A 11: 103,208,953 Q242L possibly damaging Het
Sptbn4 T G 7: 27,418,079 E415A probably damaging Het
St5 G T 7: 109,526,329 D980E probably damaging Het
St6galnac5 T C 3: 152,840,145 R259G probably damaging Het
Stat3 T C 11: 100,893,788 I589V probably benign Het
Tecta T A 9: 42,337,827 K1913M probably damaging Het
Tek C A 4: 94,873,935 N1103K probably damaging Het
Telo2 A G 17: 25,115,225 I16T probably benign Het
Tmem207 G T 16: 26,516,749 C79* probably null Het
Topaz1 C T 9: 122,750,154 H710Y probably benign Het
Trim33 T A 3: 103,331,649 S648T probably benign Het
Trpm6 A G 19: 18,873,876 T1734A possibly damaging Het
Trpm8 A G 1: 88,326,436 E127G possibly damaging Het
Ttc3 T A 16: 94,448,059 C1139S probably benign Het
Ttn T C 2: 76,749,986 E23521G probably damaging Het
Ush2a T C 1: 188,536,354 I1669T possibly damaging Het
Vcpip1 C A 1: 9,747,231 S309I possibly damaging Het
Vmn1r208 A G 13: 22,772,619 V236A probably damaging Het
Vmn1r74 T C 7: 11,847,607 F278S probably damaging Het
Vmn2r33 T C 7: 7,554,082 S540G probably benign Het
Vmn2r52 T C 7: 10,171,255 D219G probably benign Het
Wiz G T 17: 32,356,965 D812E probably benign Het
Ylpm1 C T 12: 85,044,402 P1787S probably benign Het
Zan T C 5: 137,406,426 E3858G unknown Het
Zfp760 T G 17: 21,723,291 H482Q possibly damaging Het
Zfp78 A G 7: 6,378,391 T147A probably benign Het
Zfp808 T A 13: 62,172,847 I630K possibly damaging Het
Zpld1 T A 16: 55,241,338 R227* probably null Het
Other mutations in Dnah5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dnah5 APN 15 28272342 missense probably benign
IGL00331:Dnah5 APN 15 28421620 missense probably damaging 1.00
IGL00519:Dnah5 APN 15 28444218 missense probably benign 0.10
IGL00537:Dnah5 APN 15 28458702 critical splice donor site probably null
IGL01102:Dnah5 APN 15 28410003 critical splice donor site probably null
IGL01126:Dnah5 APN 15 28302399 missense possibly damaging 0.85
IGL01154:Dnah5 APN 15 28458656 missense possibly damaging 0.75
IGL01349:Dnah5 APN 15 28294913 splice site probably benign
IGL01353:Dnah5 APN 15 28233272 missense probably benign 0.00
IGL01372:Dnah5 APN 15 28230490 missense probably benign 0.00
IGL01390:Dnah5 APN 15 28411540 missense probably benign 0.00
IGL01446:Dnah5 APN 15 28326669 missense probably damaging 1.00
IGL01472:Dnah5 APN 15 28331726 missense probably damaging 1.00
IGL01485:Dnah5 APN 15 28331726 missense probably damaging 1.00
IGL01568:Dnah5 APN 15 28229652 missense probably benign 0.01
IGL01592:Dnah5 APN 15 28236637 missense probably benign 0.01
IGL01594:Dnah5 APN 15 28311334 missense possibly damaging 0.87
IGL01677:Dnah5 APN 15 28367782 missense probably damaging 1.00
IGL01845:Dnah5 APN 15 28449169 missense probably benign 0.06
IGL01904:Dnah5 APN 15 28307364 missense probably benign 0.09
IGL01913:Dnah5 APN 15 28313753 missense possibly damaging 0.50
IGL01950:Dnah5 APN 15 28290289 missense probably null 1.00
IGL01963:Dnah5 APN 15 28370536 missense probably benign 0.12
IGL02008:Dnah5 APN 15 28343552 missense probably damaging 0.98
IGL02088:Dnah5 APN 15 28459118 critical splice acceptor site probably null
IGL02090:Dnah5 APN 15 28240041 splice site probably benign
IGL02114:Dnah5 APN 15 28397124 missense probably damaging 0.97
IGL02135:Dnah5 APN 15 28247885 missense possibly damaging 0.50
IGL02232:Dnah5 APN 15 28299240 missense probably damaging 1.00
IGL02386:Dnah5 APN 15 28340381 missense probably damaging 1.00
IGL02475:Dnah5 APN 15 28219150 missense probably benign 0.09
IGL02626:Dnah5 APN 15 28307276 missense possibly damaging 0.94
IGL02650:Dnah5 APN 15 28289047 splice site probably benign
IGL02651:Dnah5 APN 15 28350622 missense probably benign 0.05
IGL02652:Dnah5 APN 15 28366187 missense probably damaging 0.99
IGL02670:Dnah5 APN 15 28409296 missense probably damaging 1.00
IGL02697:Dnah5 APN 15 28445143 missense probably benign 0.00
IGL02721:Dnah5 APN 15 28234243 critical splice acceptor site probably null
IGL02858:Dnah5 APN 15 28453212 missense possibly damaging 0.65
IGL02859:Dnah5 APN 15 28383625 missense probably benign 0.01
IGL02945:Dnah5 APN 15 28270426 missense probably benign 0.00
IGL02949:Dnah5 APN 15 28272185 missense probably benign 0.32
IGL02971:Dnah5 APN 15 28384461 missense probably damaging 1.00
IGL03017:Dnah5 APN 15 28340325 missense possibly damaging 0.93
IGL03177:Dnah5 APN 15 28295399 missense probably damaging 0.97
IGL03212:Dnah5 APN 15 28290163 missense probably benign 0.08
IGL03224:Dnah5 APN 15 28459154 missense probably damaging 1.00
IGL03231:Dnah5 APN 15 28311148 missense probably damaging 1.00
IGL03273:Dnah5 APN 15 28458649 missense probably damaging 0.98
IGL03294:Dnah5 APN 15 28233295 critical splice donor site probably null
IGL03331:Dnah5 APN 15 28419940 missense probably damaging 1.00
IGL03337:Dnah5 APN 15 28290141 missense probably benign 0.10
IGL03367:Dnah5 APN 15 28234327 missense possibly damaging 0.95
Firtel UTSW 15 28448367 missense possibly damaging 0.95
lowbar UTSW 15 28311133 splice site probably null
notherone UTSW 15 28340406 missense probably benign 0.13
scheffler UTSW 15 28438091 splice site probably benign
IGL02837:Dnah5 UTSW 15 28269400 missense probably benign
P0008:Dnah5 UTSW 15 28302387 missense probably damaging 1.00
P0014:Dnah5 UTSW 15 28403473 missense probably damaging 1.00
PIT4687001:Dnah5 UTSW 15 28383577 missense probably damaging 0.98
R0030:Dnah5 UTSW 15 28451517 missense probably benign 0.34
R0087:Dnah5 UTSW 15 28350613 missense probably damaging 1.00
R0099:Dnah5 UTSW 15 28239934 missense probably damaging 1.00
R0102:Dnah5 UTSW 15 28245751 splice site probably benign
R0102:Dnah5 UTSW 15 28245751 splice site probably benign
R0104:Dnah5 UTSW 15 28453353 missense possibly damaging 0.88
R0112:Dnah5 UTSW 15 28263679 missense probably benign 0.00
R0122:Dnah5 UTSW 15 28378363 missense probably damaging 1.00
R0126:Dnah5 UTSW 15 28246319 missense probably benign 0.00
R0127:Dnah5 UTSW 15 28294925 missense probably damaging 1.00
R0233:Dnah5 UTSW 15 28333070 missense probably damaging 1.00
R0310:Dnah5 UTSW 15 28299110 missense probably benign 0.19
R0386:Dnah5 UTSW 15 28383581 missense probably damaging 1.00
R0421:Dnah5 UTSW 15 28229541 missense possibly damaging 0.79
R0481:Dnah5 UTSW 15 28383599 missense probably benign 0.31
R0514:Dnah5 UTSW 15 28366321 missense probably damaging 1.00
R0609:Dnah5 UTSW 15 28327779 missense probably benign
R0720:Dnah5 UTSW 15 28313861 missense probably null 0.98
R0731:Dnah5 UTSW 15 28311143 missense possibly damaging 0.78
R0747:Dnah5 UTSW 15 28444186 missense probably damaging 0.99
R0747:Dnah5 UTSW 15 28444187 missense possibly damaging 0.64
R0766:Dnah5 UTSW 15 28448487 missense probably null 0.89
R0849:Dnah5 UTSW 15 28263599 missense probably damaging 0.96
R1034:Dnah5 UTSW 15 28302471 missense probably damaging 1.00
R1084:Dnah5 UTSW 15 28343452 missense probably benign 0.01
R1148:Dnah5 UTSW 15 28421690 missense probably damaging 1.00
R1148:Dnah5 UTSW 15 28421690 missense probably damaging 1.00
R1200:Dnah5 UTSW 15 28246257 missense possibly damaging 0.88
R1208:Dnah5 UTSW 15 28327731 missense probably damaging 1.00
R1208:Dnah5 UTSW 15 28327731 missense probably damaging 1.00
R1269:Dnah5 UTSW 15 28238511 missense probably damaging 1.00
R1373:Dnah5 UTSW 15 28313918 splice site probably benign
R1401:Dnah5 UTSW 15 28401913 missense probably damaging 1.00
R1413:Dnah5 UTSW 15 28370409 missense probably benign
R1430:Dnah5 UTSW 15 28345857 missense probably benign 0.37
R1457:Dnah5 UTSW 15 28403542 critical splice donor site probably null
R1468:Dnah5 UTSW 15 28230463 nonsense probably null
R1468:Dnah5 UTSW 15 28230463 nonsense probably null
R1560:Dnah5 UTSW 15 28420003 missense probably damaging 1.00
R1568:Dnah5 UTSW 15 28409177 missense probably damaging 0.98
R1574:Dnah5 UTSW 15 28252423 missense probably benign 0.00
R1574:Dnah5 UTSW 15 28252423 missense probably benign 0.00
R1603:Dnah5 UTSW 15 28294985 splice site probably benign
R1603:Dnah5 UTSW 15 28449180 missense probably benign 0.09
R1673:Dnah5 UTSW 15 28290148 missense probably benign
R1755:Dnah5 UTSW 15 28326636 missense probably damaging 0.99
R1785:Dnah5 UTSW 15 28313786 missense probably damaging 1.00
R1786:Dnah5 UTSW 15 28313786 missense probably damaging 1.00
R1789:Dnah5 UTSW 15 28270426 missense probably benign 0.00
R1817:Dnah5 UTSW 15 28246400 nonsense probably null
R1819:Dnah5 UTSW 15 28246400 nonsense probably null
R1834:Dnah5 UTSW 15 28409124 missense probably benign 0.00
R1855:Dnah5 UTSW 15 28411669 missense possibly damaging 0.88
R1870:Dnah5 UTSW 15 28331713 nonsense probably null
R1871:Dnah5 UTSW 15 28331713 nonsense probably null
R1987:Dnah5 UTSW 15 28343591 missense probably damaging 0.99
R1988:Dnah5 UTSW 15 28343591 missense probably damaging 0.99
R1989:Dnah5 UTSW 15 28343591 missense probably damaging 0.99
R2062:Dnah5 UTSW 15 28366270 missense probably damaging 1.00
R2069:Dnah5 UTSW 15 28312388 splice site probably null
R2121:Dnah5 UTSW 15 28297005 splice site probably benign
R2128:Dnah5 UTSW 15 28408321 missense probably benign 0.00
R2129:Dnah5 UTSW 15 28408321 missense probably benign 0.00
R2151:Dnah5 UTSW 15 28444091 missense probably damaging 1.00
R2159:Dnah5 UTSW 15 28252545 missense probably benign 0.00
R2207:Dnah5 UTSW 15 28343671 missense probably benign 0.11
R2231:Dnah5 UTSW 15 28408417 critical splice donor site probably null
R2232:Dnah5 UTSW 15 28408417 critical splice donor site probably null
R2282:Dnah5 UTSW 15 28327302 missense probably damaging 0.99
R2305:Dnah5 UTSW 15 28387767 missense probably benign 0.25
R2339:Dnah5 UTSW 15 28313882 missense probably benign 0.00
R2437:Dnah5 UTSW 15 28307391 critical splice donor site probably null
R2696:Dnah5 UTSW 15 28278576 missense probably benign 0.00
R3156:Dnah5 UTSW 15 28438091 splice site probably benign
R3431:Dnah5 UTSW 15 28295267 missense probably benign 0.20
R3700:Dnah5 UTSW 15 28387791 missense possibly damaging 0.72
R3724:Dnah5 UTSW 15 28270420 missense probably benign 0.08
R3732:Dnah5 UTSW 15 28409122 missense possibly damaging 0.64
R3872:Dnah5 UTSW 15 28411510 missense possibly damaging 0.50
R4063:Dnah5 UTSW 15 28420998 missense probably damaging 0.98
R4072:Dnah5 UTSW 15 28340298 nonsense probably null
R4075:Dnah5 UTSW 15 28293791 missense probably benign
R4245:Dnah5 UTSW 15 28219189 missense probably benign
R4254:Dnah5 UTSW 15 28438102 missense probably benign 0.07
R4255:Dnah5 UTSW 15 28438102 missense probably benign 0.07
R4392:Dnah5 UTSW 15 28289229 missense probably benign 0.19
R4552:Dnah5 UTSW 15 28397154 missense probably benign 0.19
R4574:Dnah5 UTSW 15 28367763 missense probably benign 0.05
R4577:Dnah5 UTSW 15 28289250 missense probably benign 0.06
R4587:Dnah5 UTSW 15 28304599 missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28401953 missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28419994 missense probably damaging 1.00
R4676:Dnah5 UTSW 15 28295260 missense possibly damaging 0.65
R4707:Dnah5 UTSW 15 28372375 missense probably damaging 0.97
R4754:Dnah5 UTSW 15 28420955 splice site probably null
R4767:Dnah5 UTSW 15 28270474 missense probably benign 0.02
R4857:Dnah5 UTSW 15 28345807 missense probably benign 0.00
R4883:Dnah5 UTSW 15 28343638 missense probably benign 0.00
R4889:Dnah5 UTSW 15 28235792 missense probably benign 0.01
R4946:Dnah5 UTSW 15 28326557 missense probably damaging 0.96
R4946:Dnah5 UTSW 15 28387904 missense probably damaging 1.00
R4947:Dnah5 UTSW 15 28272372 missense probably benign
R5033:Dnah5 UTSW 15 28421678 missense probably damaging 0.96
R5164:Dnah5 UTSW 15 28408292 missense probably benign 0.00
R5175:Dnah5 UTSW 15 28448404 missense probably damaging 1.00
R5182:Dnah5 UTSW 15 28311278 missense probably damaging 0.99
R5187:Dnah5 UTSW 15 28272172 missense probably benign 0.41
R5272:Dnah5 UTSW 15 28350665 missense probably benign
R5308:Dnah5 UTSW 15 28229651 missense possibly damaging 0.80
R5310:Dnah5 UTSW 15 28311328 missense probably damaging 1.00
R5322:Dnah5 UTSW 15 28384244 missense probably benign 0.41
R5398:Dnah5 UTSW 15 28293726 missense probably benign
R5596:Dnah5 UTSW 15 28343608 missense probably damaging 1.00
R5603:Dnah5 UTSW 15 28419932 missense probably damaging 1.00
R5619:Dnah5 UTSW 15 28302435 missense probably damaging 1.00
R5656:Dnah5 UTSW 15 28421064 missense probably benign 0.03
R5741:Dnah5 UTSW 15 28246367 missense probably benign 0.11
R5754:Dnah5 UTSW 15 28401868 missense probably benign 0.01
R5763:Dnah5 UTSW 15 28311152 missense probably damaging 1.00
R5824:Dnah5 UTSW 15 28313821 missense probably benign 0.00
R5836:Dnah5 UTSW 15 28383592 missense probably damaging 1.00
R5838:Dnah5 UTSW 15 28290195 missense probably benign 0.00
R5864:Dnah5 UTSW 15 28297013 missense possibly damaging 0.83
R5895:Dnah5 UTSW 15 28234453 splice site probably null
R5896:Dnah5 UTSW 15 28272060 missense probably benign
R5899:Dnah5 UTSW 15 28448367 missense possibly damaging 0.95
R5905:Dnah5 UTSW 15 28387833 missense probably damaging 1.00
R5924:Dnah5 UTSW 15 28307327 missense probably benign 0.41
R5927:Dnah5 UTSW 15 28335718 missense probably benign 0.00
R5929:Dnah5 UTSW 15 28311207 missense probably benign 0.01
R5929:Dnah5 UTSW 15 28311208 missense probably damaging 1.00
R5931:Dnah5 UTSW 15 28453279 missense probably damaging 0.99
R5964:Dnah5 UTSW 15 28458584 missense possibly damaging 0.49
R5975:Dnah5 UTSW 15 28234282 missense probably damaging 1.00
R5993:Dnah5 UTSW 15 28299226 missense probably benign 0.09
R6016:Dnah5 UTSW 15 28327884 missense probably damaging 1.00
R6028:Dnah5 UTSW 15 28387833 missense probably damaging 1.00
R6065:Dnah5 UTSW 15 28230468 missense possibly damaging 0.47
R6117:Dnah5 UTSW 15 28270420 missense probably damaging 0.99
R6143:Dnah5 UTSW 15 28233231 missense probably benign 0.05
R6146:Dnah5 UTSW 15 28459185 missense probably benign
R6154:Dnah5 UTSW 15 28204031 missense probably benign 0.15
R6164:Dnah5 UTSW 15 28378343 missense probably benign 0.08
R6266:Dnah5 UTSW 15 28335627 missense possibly damaging 0.67
R6321:Dnah5 UTSW 15 28372411 missense probably damaging 0.99
R6349:Dnah5 UTSW 15 28238511 missense probably damaging 1.00
R6431:Dnah5 UTSW 15 28349824 missense possibly damaging 0.52
R6467:Dnah5 UTSW 15 28438183 missense probably benign 0.10
R6564:Dnah5 UTSW 15 28367745 missense probably benign
R6607:Dnah5 UTSW 15 28445200 missense possibly damaging 0.95
R6619:Dnah5 UTSW 15 28409120 missense probably benign 0.03
R6633:Dnah5 UTSW 15 28293787 missense probably benign 0.27
R6647:Dnah5 UTSW 15 28403487 missense probably benign 0.02
R6782:Dnah5 UTSW 15 28449156 missense possibly damaging 0.89
R6797:Dnah5 UTSW 15 28233238 nonsense probably null
R6797:Dnah5 UTSW 15 28451463 missense probably damaging 1.00
R6831:Dnah5 UTSW 15 28411515 missense possibly damaging 0.88
R6849:Dnah5 UTSW 15 28278624 missense probably benign 0.14
R6871:Dnah5 UTSW 15 28229640 missense probably benign 0.32
R6936:Dnah5 UTSW 15 28409268 missense probably damaging 1.00
R6943:Dnah5 UTSW 15 28235720 missense probably damaging 1.00
R7030:Dnah5 UTSW 15 28238592 missense probably benign
R7030:Dnah5 UTSW 15 28333062 missense probably benign 0.00
R7032:Dnah5 UTSW 15 28326650 missense probably damaging 1.00
R7063:Dnah5 UTSW 15 28233248 missense probably benign 0.00
R7094:Dnah5 UTSW 15 28453336 missense probably damaging 0.98
R7097:Dnah5 UTSW 15 28453264 missense probably benign 0.00
R7126:Dnah5 UTSW 15 28349837 missense probably benign 0.03
R7153:Dnah5 UTSW 15 28365522 splice site probably null
R7209:Dnah5 UTSW 15 28459225 missense possibly damaging 0.71
R7276:Dnah5 UTSW 15 28367838 missense probably damaging 1.00
R7320:Dnah5 UTSW 15 28270470 missense probably null 0.33
R7350:Dnah5 UTSW 15 28235819 critical splice donor site probably null
R7380:Dnah5 UTSW 15 28370378 missense probably damaging 1.00
R7438:Dnah5 UTSW 15 28346952 missense probably damaging 0.99
R7499:Dnah5 UTSW 15 28302450 missense probably damaging 1.00
R7513:Dnah5 UTSW 15 28370415 missense probably benign
R7519:Dnah5 UTSW 15 28390483 missense probably damaging 0.98
R7524:Dnah5 UTSW 15 28297066 missense possibly damaging 0.50
R7556:Dnah5 UTSW 15 28290243 missense probably null 0.43
R7570:Dnah5 UTSW 15 28346952 missense probably damaging 1.00
R7585:Dnah5 UTSW 15 28401868 missense probably benign 0.09
R7642:Dnah5 UTSW 15 28247979 critical splice donor site probably null
R7670:Dnah5 UTSW 15 28246232 splice site probably null
R7763:Dnah5 UTSW 15 28313855 missense probably damaging 1.00
R7821:Dnah5 UTSW 15 28411532 missense possibly damaging 0.89
R7826:Dnah5 UTSW 15 28367812 missense probably damaging 1.00
R7872:Dnah5 UTSW 15 28245684 missense probably damaging 0.99
R7889:Dnah5 UTSW 15 28448414 nonsense probably null
R7919:Dnah5 UTSW 15 28350596 missense probably damaging 1.00
R7920:Dnah5 UTSW 15 28453222 missense probably benign 0.00
R7936:Dnah5 UTSW 15 28345837 missense possibly damaging 0.64
R7996:Dnah5 UTSW 15 28409177 missense probably damaging 0.98
R8063:Dnah5 UTSW 15 28230583 missense probably benign
R8084:Dnah5 UTSW 15 28387953 missense probably damaging 1.00
R8105:Dnah5 UTSW 15 28372402 missense probably benign
R8114:Dnah5 UTSW 15 28239976 missense probably benign 0.01
R8142:Dnah5 UTSW 15 28384373 missense probably benign 0.36
R8153:Dnah5 UTSW 15 28384430 missense probably damaging 1.00
R8161:Dnah5 UTSW 15 28350704 missense possibly damaging 0.79
R8174:Dnah5 UTSW 15 28311133 splice site probably null
R8187:Dnah5 UTSW 15 28384209 missense probably damaging 1.00
R8194:Dnah5 UTSW 15 28453268 missense probably damaging 0.99
R8280:Dnah5 UTSW 15 28408392 missense probably benign 0.01
R8291:Dnah5 UTSW 15 28263597 missense probably benign 0.03
R8324:Dnah5 UTSW 15 28346865 missense probably damaging 1.00
R8347:Dnah5 UTSW 15 28236666 missense possibly damaging 0.90
R8356:Dnah5 UTSW 15 28444167 missense probably benign 0.03
R8356:Dnah5 UTSW 15 28444323 missense probably null 0.02
R8361:Dnah5 UTSW 15 28331810 missense probably damaging 0.98
R8375:Dnah5 UTSW 15 28327343 missense probably benign 0.00
R8474:Dnah5 UTSW 15 28247832 missense probably benign 0.00
R8481:Dnah5 UTSW 15 28419795 missense probably benign 0.00
R8494:Dnah5 UTSW 15 28345831 missense probably benign 0.32
R8495:Dnah5 UTSW 15 28409268 missense probably damaging 0.97
R8519:Dnah5 UTSW 15 28299099 missense probably benign 0.07
R8683:Dnah5 UTSW 15 28289221 missense probably benign 0.00
R8739:Dnah5 UTSW 15 28345860 missense probably benign 0.01
R8752:Dnah5 UTSW 15 28290219 missense probably benign 0.00
R8784:Dnah5 UTSW 15 28387951 missense probably benign 0.16
R8813:Dnah5 UTSW 15 28229573 missense probably damaging 1.00
R8862:Dnah5 UTSW 15 28459356 splice site probably benign
R8873:Dnah5 UTSW 15 28219188 missense probably benign
R8885:Dnah5 UTSW 15 28327740 missense probably damaging 1.00
R8901:Dnah5 UTSW 15 28365569 missense possibly damaging 0.76
R9025:Dnah5 UTSW 15 28409266 missense probably damaging 1.00
R9037:Dnah5 UTSW 15 28247958 missense probably benign 0.05
R9057:Dnah5 UTSW 15 28390868 missense probably damaging 1.00
R9059:Dnah5 UTSW 15 28245666 missense probably benign
R9065:Dnah5 UTSW 15 28293790 missense probably benign 0.09
R9098:Dnah5 UTSW 15 28419961 missense
R9118:Dnah5 UTSW 15 28401848 frame shift probably null
R9149:Dnah5 UTSW 15 28387768 missense probably benign 0.00
R9184:Dnah5 UTSW 15 28340406 missense probably benign 0.13
R9205:Dnah5 UTSW 15 28448334 missense possibly damaging 0.88
R9297:Dnah5 UTSW 15 28203908 start gained probably benign
R9302:Dnah5 UTSW 15 28239886 missense probably benign 0.03
R9310:Dnah5 UTSW 15 28448433 missense probably damaging 1.00
R9318:Dnah5 UTSW 15 28203908 start gained probably benign
R9405:Dnah5 UTSW 15 28272160 missense probably benign
R9424:Dnah5 UTSW 15 28272140 missense probably benign 0.01
R9467:Dnah5 UTSW 15 28366147 missense possibly damaging 0.94
R9469:Dnah5 UTSW 15 28421000 missense probably benign 0.06
R9548:Dnah5 UTSW 15 28327879 missense possibly damaging 0.79
R9576:Dnah5 UTSW 15 28272140 missense probably benign 0.01
R9593:Dnah5 UTSW 15 28236628 missense probably benign
R9644:Dnah5 UTSW 15 28230504 missense probably damaging 0.98
R9655:Dnah5 UTSW 15 28242754 missense probably benign
R9657:Dnah5 UTSW 15 28409943 missense probably damaging 1.00
R9704:Dnah5 UTSW 15 28247819 missense probably benign 0.00
R9797:Dnah5 UTSW 15 28233170 missense probably benign 0.34
RF009:Dnah5 UTSW 15 28204019 missense probably benign 0.00
X0011:Dnah5 UTSW 15 28408381 missense probably benign 0.16
X0018:Dnah5 UTSW 15 28269354 missense probably benign 0.00
X0022:Dnah5 UTSW 15 28270411 missense probably benign 0.01
X0023:Dnah5 UTSW 15 28384308 missense probably damaging 0.99
X0028:Dnah5 UTSW 15 28470477 missense probably damaging 1.00
Z1088:Dnah5 UTSW 15 28366357 missense probably null 0.10
Z1088:Dnah5 UTSW 15 28384230 missense probably damaging 1.00
Z1177:Dnah5 UTSW 15 28270354 missense probably benign 0.32
Z1177:Dnah5 UTSW 15 28270403 missense probably benign 0.00
Z1177:Dnah5 UTSW 15 28295311 missense probably damaging 0.98
Z1177:Dnah5 UTSW 15 28387763 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- ATTTGAAGCTTTCACTGACCGC -3'
(R):5'- GCACTGAATGAAAGGGACCC -3'

Sequencing Primer
(F):5'- TTTCACTGACCGCAGAGACG -3'
(R):5'- CTGAATGAAAGGGACCCTCCTTATG -3'
Posted On 2022-08-09