Mutagenetix > Incidental Mutation

Incidental Mutation 'R9564:Trpm6'

721429

Institutional Source

Beutler Lab

Gene Symbol

Trpm6

Ensembl Gene

ENSMUSG00000024727

Gene Name

transient receptor potential cation channel, subfamily M, member 6

Synonyms

CHAK2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9564 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

18749983-18892510 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 18873876 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1734 (T1734A)

Ref Sequence

ENSEMBL: ENSMUSP00000037443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040489]

AlphaFold

Q8CIR4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040489
AA Change: T1734A

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: T1734A

Domain	Start	End	E-Value	Type
Blast:ANK	430	459	4e-8	BLAST
low complexity region	580	604	N/A	INTRINSIC
transmembrane domain	749	766	N/A	INTRINSIC
Pfam:Ion_trans	847	1087	2.8e-13	PFAM
low complexity region	1113	1126	N/A	INTRINSIC
low complexity region	1136	1154	N/A	INTRINSIC
Pfam:TRPM_tetra	1176	1231	7.5e-27	PFAM
low complexity region	1320	1331	N/A	INTRINSIC
low complexity region	1578	1596	N/A	INTRINSIC
Blast:Alpha_kinase	1618	1673	9e-11	BLAST
low complexity region	1682	1695	N/A	INTRINSIC
Alpha_kinase	1761	1978	1e-84	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 135 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700097O09Rik	A	T	12: 55,057,305	N176K	possibly damaging	Het
3110009E18Rik	T	A	1: 120,169,276	V134E		Het
9130409I23Rik	G	T	1: 181,055,245	V191F	possibly damaging	Het
Abca8a	T	A	11: 110,074,184	H429L	probably benign	Het
Acsf2	T	A	11: 94,573,065	I98F	possibly damaging	Het
Actr5	A	G	2: 158,628,215	D255G	probably damaging	Het
Adam21	C	T	12: 81,559,059	C643Y	probably damaging	Het
Adcy7	TGG	TG	8: 88,326,425		probably null	Het
AI429214	A	G	8: 36,993,913	S72G	possibly damaging	Het
Akap13	T	C	7: 75,609,413	V595A	probably benign	Het
Akt3	T	C	1: 177,080,203	T209A	possibly damaging	Het
Alpk2	C	T	18: 65,305,943	G793D	probably damaging	Het
Amotl1	T	C	9: 14,562,217	K562R	possibly damaging	Het
Ankib1	T	A	5: 3,755,733	N178I	possibly damaging	Het
Arfgef1	A	T	1: 10,147,533	D1560E	probably benign	Het
Arhgap20	AAGAGAG	AAGAG	9: 51,850,113		probably null	Het
Arpc5l	A	G	2: 39,015,112	T152A	probably benign	Het
Asic3	C	G	5: 24,415,877	D252E	possibly damaging	Het
Atf7	T	A	15: 102,534,277	M466L	probably benign	Het
Bcl9l	A	G	9: 44,509,257	D1320G	probably damaging	Het
Bdkrb1	G	A	12: 105,604,819	V215I	probably benign	Het
Brpf3	T	G	17: 28,807,178	D408E	probably benign	Het
Btn2a2	C	A	13: 23,478,678	K367N	possibly damaging	Het
Btnl10	T	A	11: 58,922,363	F273I	probably benign	Het
C1qtnf12	C	T	4: 155,965,016	T145I	probably benign	Het
Cacna1s	T	C	1: 136,118,778	C1763R	probably benign	Het
Ccdc154	C	A	17: 25,168,407	Q372K	possibly damaging	Het
Cd300ld2	CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG	CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG	11: 115,012,431		probably benign	Het
Celsr2	T	C	3: 108,414,518	Y326C	probably damaging	Het
Cfap46	A	T	7: 139,651,555	V914E		Het
Coil	T	A	11: 88,981,800	V329E	possibly damaging	Het
Copb1	A	G	7: 114,236,799	I449T	possibly damaging	Het
Copg1	T	G	6: 87,892,701	S187R	probably damaging	Het
Cps1	T	A	1: 67,158,889	F371Y	probably benign	Het
Cpt1b	A	T	15: 89,419,269	F554L	probably damaging	Het
Ctdsp2	A	G	10: 126,996,171	D216G	probably damaging	Het
Ctla2b	A	T	13: 60,896,042	Y104*	probably null	Het
Cyp2j6	A	G	4: 96,526,008	I340T	probably damaging	Het
Ddi1	T	A	9: 6,265,730	D213V	probably damaging	Het
Dlgap1	T	G	17: 70,657,463	N400K	probably benign	Het
Dnah5	G	A	15: 28,290,276	V1271M	probably benign	Het
Dnah8	T	A	17: 30,713,047	V1463E	probably benign	Het
Dstyk	G	A	1: 132,434,285	R151H	probably damaging	Het
Ehd3	T	G	17: 73,830,366	V510G	probably benign	Het
Enthd1	G	T	15: 80,560,034	Q107K	probably damaging	Het
Entpd7	A	G	19: 43,717,450	E237G	probably benign	Het
Fadd	A	T	7: 144,582,311	C27S	probably damaging	Het
Fan1	A	G	7: 64,349,492	L874P	possibly damaging	Het
Fbxw17	T	C	13: 50,425,569	W141R	probably damaging	Het
Fig4	A	G	10: 41,285,391	V63A	probably benign	Het
Fmo3	T	C	1: 162,958,452	D323G	probably damaging	Het
Gas8	T	A	8: 123,536,440	V452E	possibly damaging	Het
Gdf9	T	A	11: 53,436,684	S156T	probably damaging	Het
Gm15922	C	T	7: 3,739,647	V21M	possibly damaging	Het
Gm884	T	C	11: 103,612,996	I2715M	unknown	Het
Hlcs	T	C	16: 94,134,721	S571G	probably benign	Het
Hmox2	A	G	16: 4,765,006	Y201C	probably damaging	Het
Ikzf3	T	A	11: 98,467,206	D435V	probably damaging	Het
Kank2	T	C	9: 21,794,556	T389A	possibly damaging	Het
Kank2	A	G	9: 21,795,335	L129P	probably damaging	Het
Kdr	T	A	5: 75,964,905	K339N	probably benign	Het
Lmntd2	A	G	7: 141,210,788	S516P		Het
Lrrc40	T	A	3: 158,040,441	V51D	probably benign	Het
Lrrtm1	A	G	6: 77,244,553	N331S	probably benign	Het
Lvrn	T	G	18: 46,884,439	I612S	probably damaging	Het
Map3k3	T	A	11: 106,151,034	I413N	probably damaging	Het
Mcm9	C	T	10: 53,630,008	A57T	possibly damaging	Het
Met	T	A	6: 17,531,426	F568I	probably benign	Het
Mkx	A	G	18: 7,002,457	F30L	probably benign	Het
Mrc1	A	G	2: 14,261,306	N345S	probably benign	Het
Mstn	T	A	1: 53,064,208	N234K	probably benign	Het
Mtmr3	A	T	11: 4,490,992	S554T	possibly damaging	Het
Mug1	G	A	6: 121,884,628	V1350I	probably benign	Het
Myh8	T	C	11: 67,286,389	V427A	probably benign	Het
Nr4a2	A	T	2: 57,110,178	I365N	probably damaging	Het
Nrxn2	A	G	19: 6,509,857	D1215G	probably damaging	Het
Olfr709-ps1	A	G	7: 106,926,640	M273T	probably benign	Het
Olfr820	T	C	10: 130,017,418	I19T	probably benign	Het
Olfr830	G	A	9: 18,875,344	V3I	probably benign	Het
Osbpl6	T	A	2: 76,595,977	W967R	probably damaging	Het
Pcdhb21	T	C	18: 37,513,919	S34P	possibly damaging	Het
Pibf1	G	T	14: 99,137,174	D350Y	possibly damaging	Het
Plekhs1	A	T	19: 56,473,196	I123F	probably damaging	Het
Pold2	C	T	11: 5,874,163	G214D	probably benign	Het
Pomc	A	G	12: 3,959,971	T71A	probably benign	Het
Pot1b	A	G	17: 55,662,465	S568P	possibly damaging	Het
Prkd2	C	A	7: 16,857,819	Q592K	possibly damaging	Het
Prss28	C	T	17: 25,309,937	A84V	probably damaging	Het
Prtg	T	A	9: 72,858,871	Y649N	probably damaging	Het
Psip1	T	C	4: 83,468,651	E161G	possibly damaging	Het
Rab3gap2	A	G	1: 185,282,494	D1280G	probably damaging	Het
Rab3ip	A	T	10: 116,915,875	I329N	probably damaging	Het
Rarres2	C	T	6: 48,572,230	G13D	possibly damaging	Het
Rbp3	A	G	14: 33,955,520	D475G	probably damaging	Het
Ric3	A	G	7: 109,038,811	V246A	probably damaging	Het
Robo3	A	G	9: 37,429,604	F124S	probably damaging	Het
Rpl27a	C	A	7: 109,519,630	H17N	probably benign	Het
Rptn	A	G	3: 93,397,229	D623G	probably benign	Het
Rtl1	G	T	12: 109,590,279	Q1709K	probably benign	Het
Sacs	T	A	14: 61,211,597	D3697E	probably damaging	Het
Sec61b	A	G	4: 47,483,049	Y93C	probably damaging	Het
Serpina3a	A	T	12: 104,118,627	I94L	probably benign	Het
Skiv2l	C	T	17: 34,844,782	A562T	probably benign	Het
Skor2	C	T	18: 76,858,681	H33Y	unknown	Het
Slc12a3	G	A	8: 94,356,355	V874I	probably benign	Het
Slit1	T	A	19: 41,603,422	M1254L	probably benign	Het
Smg1	A	G	7: 118,212,985	S52P	unknown	Het
Sorl1	A	G	9: 42,046,597	Y584H	probably damaging	Het
Spata32	T	A	11: 103,208,953	Q242L	possibly damaging	Het
Sptbn4	T	G	7: 27,418,079	E415A	probably damaging	Het
St5	G	T	7: 109,526,329	D980E	probably damaging	Het
St6galnac5	T	C	3: 152,840,145	R259G	probably damaging	Het
Stat3	T	C	11: 100,893,788	I589V	probably benign	Het
Tecta	T	A	9: 42,337,827	K1913M	probably damaging	Het
Tek	C	A	4: 94,873,935	N1103K	probably damaging	Het
Telo2	A	G	17: 25,115,225	I16T	probably benign	Het
Tmem207	G	T	16: 26,516,749	C79*	probably null	Het
Topaz1	C	T	9: 122,750,154	H710Y	probably benign	Het
Trim33	T	A	3: 103,331,649	S648T	probably benign	Het
Trpm8	A	G	1: 88,326,436	E127G	possibly damaging	Het
Ttc3	T	A	16: 94,448,059	C1139S	probably benign	Het
Ttn	T	C	2: 76,749,986	E23521G	probably damaging	Het
Ush2a	T	C	1: 188,536,354	I1669T	possibly damaging	Het
Vcpip1	C	A	1: 9,747,231	S309I	possibly damaging	Het
Vmn1r208	A	G	13: 22,772,619	V236A	probably damaging	Het
Vmn1r74	T	C	7: 11,847,607	F278S	probably damaging	Het
Vmn2r33	T	C	7: 7,554,082	S540G	probably benign	Het
Vmn2r52	T	C	7: 10,171,255	D219G	probably benign	Het
Wiz	G	T	17: 32,356,965	D812E	probably benign	Het
Ylpm1	C	T	12: 85,044,402	P1787S	probably benign	Het
Zan	T	C	5: 137,406,426	E3858G	unknown	Het
Zfp760	T	G	17: 21,723,291	H482Q	possibly damaging	Het
Zfp78	A	G	7: 6,378,391	T147A	probably benign	Het
Zfp808	T	A	13: 62,172,847	I630K	possibly damaging	Het
Zpld1	T	A	16: 55,241,338	R227*	probably null	Het

Other mutations in Trpm6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Trpm6	APN	19	18783908	splice site	probably benign
IGL00862:Trpm6	APN	19	18827528	missense	probably damaging	1.00
IGL01348:Trpm6	APN	19	18877651	missense	probably damaging	1.00
IGL01400:Trpm6	APN	19	18825794	nonsense	probably null
IGL01451:Trpm6	APN	19	18809569	missense	probably damaging	1.00
IGL01508:Trpm6	APN	19	18796530	nonsense	probably null
IGL01995:Trpm6	APN	19	18830327	splice site	probably benign
IGL02092:Trpm6	APN	19	18772331	missense	possibly damaging	0.59
IGL02152:Trpm6	APN	19	18832539	missense	possibly damaging	0.93
IGL02294:Trpm6	APN	19	18854063	missense	probably benign
IGL02329:Trpm6	APN	19	18854217	missense	probably benign	0.17
IGL02366:Trpm6	APN	19	18778510	splice site	probably benign
IGL02402:Trpm6	APN	19	18786756	missense	probably benign	0.18
IGL02457:Trpm6	APN	19	18825791	missense	probably damaging	1.00
IGL02457:Trpm6	APN	19	18827398	nonsense	probably null
IGL02684:Trpm6	APN	19	18802207	splice site	probably benign
IGL02705:Trpm6	APN	19	18776733	critical splice donor site	probably null
IGL02728:Trpm6	APN	19	18809652	missense	possibly damaging	0.71
IGL02742:Trpm6	APN	19	18830012	splice site	probably benign
IGL02818:Trpm6	APN	19	18866257	missense	probably benign	0.04
IGL02836:Trpm6	APN	19	18813482	missense	probably damaging	1.00
IGL03119:Trpm6	APN	19	18838017	nonsense	probably null
IGL03193:Trpm6	APN	19	18825872	missense	possibly damaging	0.94
IGL03227:Trpm6	APN	19	18819119	missense	probably benign	0.01
IGL03227:Trpm6	APN	19	18786779	missense	probably benign	0.12
IGL03231:Trpm6	APN	19	18819181	missense	probably benign
IGL03245:Trpm6	APN	19	18877701	missense	probably damaging	1.00
IGL03328:Trpm6	APN	19	18838082	missense	possibly damaging	0.94
IGL03341:Trpm6	APN	19	18813486	missense	probably benign
P0043:Trpm6	UTSW	19	18877765	missense	probably damaging	1.00
PIT4260001:Trpm6	UTSW	19	18825802	missense	possibly damaging	0.48
R0057:Trpm6	UTSW	19	18786755	missense	probably benign	0.05
R0115:Trpm6	UTSW	19	18829952	missense	probably damaging	0.98
R0119:Trpm6	UTSW	19	18832593	missense	probably benign	0.05
R0140:Trpm6	UTSW	19	18819194	splice site	probably null
R0267:Trpm6	UTSW	19	18823378	missense	probably benign
R0350:Trpm6	UTSW	19	18883957	splice site	probably null
R0373:Trpm6	UTSW	19	18853587	missense	probably benign	0.15
R0393:Trpm6	UTSW	19	18778644	missense	probably damaging	0.99
R0416:Trpm6	UTSW	19	18783025	splice site	probably benign
R0505:Trpm6	UTSW	19	18873902	splice site	probably benign
R0526:Trpm6	UTSW	19	18792876	missense	probably damaging	0.97
R0607:Trpm6	UTSW	19	18872221	missense	probably benign	0.00
R0609:Trpm6	UTSW	19	18825862	missense	probably damaging	0.97
R0714:Trpm6	UTSW	19	18838087	missense	possibly damaging	0.90
R1215:Trpm6	UTSW	19	18796498	missense	probably damaging	1.00
R1474:Trpm6	UTSW	19	18796495	missense	probably benign	0.28
R1512:Trpm6	UTSW	19	18875931	missense	probably benign
R1558:Trpm6	UTSW	19	18786828	missense	probably benign	0.04
R1597:Trpm6	UTSW	19	18827524	missense	probably damaging	0.98
R1618:Trpm6	UTSW	19	18877631	missense	possibly damaging	0.88
R1779:Trpm6	UTSW	19	18856217	missense	probably damaging	1.00
R1796:Trpm6	UTSW	19	18827567	missense	possibly damaging	0.90
R1799:Trpm6	UTSW	19	18891999	splice site	probably null
R1840:Trpm6	UTSW	19	18866267	missense	probably benign	0.21
R1991:Trpm6	UTSW	19	18796284	missense	probably benign	0.00
R2030:Trpm6	UTSW	19	18854265	missense	probably benign
R2073:Trpm6	UTSW	19	18876042	missense	probably damaging	1.00
R2074:Trpm6	UTSW	19	18877739	missense	probably damaging	1.00
R2096:Trpm6	UTSW	19	18825752	missense	probably damaging	0.97
R2103:Trpm6	UTSW	19	18796284	missense	probably benign	0.00
R2106:Trpm6	UTSW	19	18813350	missense	possibly damaging	0.95
R2117:Trpm6	UTSW	19	18829952	missense	probably damaging	0.98
R2850:Trpm6	UTSW	19	18792090	missense	possibly damaging	0.68
R3125:Trpm6	UTSW	19	18854431	missense	probably benign	0.05
R3719:Trpm6	UTSW	19	18772393	nonsense	probably null
R3779:Trpm6	UTSW	19	18876039	missense	possibly damaging	0.80
R4115:Trpm6	UTSW	19	18832557	missense	probably damaging	1.00
R4367:Trpm6	UTSW	19	18827525	missense	probably damaging	0.99
R4523:Trpm6	UTSW	19	18796500	missense	probably damaging	1.00
R4546:Trpm6	UTSW	19	18832477	missense	probably damaging	1.00
R4564:Trpm6	UTSW	19	18832597	missense	possibly damaging	0.95
R4565:Trpm6	UTSW	19	18825872	missense	probably damaging	1.00
R4697:Trpm6	UTSW	19	18853791	missense	probably benign	0.01
R4714:Trpm6	UTSW	19	18854200	missense	possibly damaging	0.93
R4750:Trpm6	UTSW	19	18876064	missense	probably damaging	0.99
R4771:Trpm6	UTSW	19	18813493	missense	probably damaging	0.97
R4791:Trpm6	UTSW	19	18867981	missense	probably benign	0.00
R4814:Trpm6	UTSW	19	18862212	missense	probably benign	0.11
R5028:Trpm6	UTSW	19	18786760	missense	probably damaging	1.00
R5237:Trpm6	UTSW	19	18813464	missense	probably damaging	1.00
R5615:Trpm6	UTSW	19	18829933	missense	probably damaging	0.96
R5642:Trpm6	UTSW	19	18830207	missense	probably damaging	1.00
R5645:Trpm6	UTSW	19	18853604	missense	probably damaging	1.00
R5726:Trpm6	UTSW	19	18853617	missense	probably damaging	1.00
R5832:Trpm6	UTSW	19	18786819	missense	possibly damaging	0.66
R5843:Trpm6	UTSW	19	18856175	missense	probably benign	0.04
R5955:Trpm6	UTSW	19	18892019	missense	possibly damaging	0.75
R6101:Trpm6	UTSW	19	18853748	nonsense	probably null
R6105:Trpm6	UTSW	19	18853748	nonsense	probably null
R6211:Trpm6	UTSW	19	18783128	missense	probably damaging	1.00
R6228:Trpm6	UTSW	19	18854291	missense	probably damaging	1.00
R6263:Trpm6	UTSW	19	18854108	missense	possibly damaging	0.94
R6453:Trpm6	UTSW	19	18829990	missense	probably damaging	1.00
R6562:Trpm6	UTSW	19	18838042	missense	probably damaging	1.00
R6624:Trpm6	UTSW	19	18796439	critical splice acceptor site	probably null
R6624:Trpm6	UTSW	19	18889020	missense	probably damaging	1.00
R6729:Trpm6	UTSW	19	18830297	missense	probably damaging	1.00
R6765:Trpm6	UTSW	19	18877765	missense	probably damaging	1.00
R6976:Trpm6	UTSW	19	18783163	missense	probably benign
R7103:Trpm6	UTSW	19	18813547	missense	possibly damaging	0.87
R7126:Trpm6	UTSW	19	18854033	nonsense	probably null
R7128:Trpm6	UTSW	19	18811773	missense	possibly damaging	0.92
R7157:Trpm6	UTSW	19	18838098	missense	possibly damaging	0.91
R7212:Trpm6	UTSW	19	18853791	missense	probably benign	0.01
R7263:Trpm6	UTSW	19	18876786	missense	probably damaging	1.00
R7268:Trpm6	UTSW	19	18778585	missense	probably benign	0.13
R7305:Trpm6	UTSW	19	18876091	missense	probably benign	0.30
R7498:Trpm6	UTSW	19	18876120	missense	probably damaging	1.00
R7558:Trpm6	UTSW	19	18778665	missense	probably damaging	0.96
R7590:Trpm6	UTSW	19	18832581	missense	probably benign	0.31
R7646:Trpm6	UTSW	19	18867961	missense	probably benign	0.10
R7650:Trpm6	UTSW	19	18876013	missense	possibly damaging	0.70
R7727:Trpm6	UTSW	19	18854249	missense	probably damaging	0.97
R7743:Trpm6	UTSW	19	18827408	missense	probably benign	0.03
R7747:Trpm6	UTSW	19	18750045	splice site	probably null
R7807:Trpm6	UTSW	19	18829856	missense	probably benign	0.11
R7870:Trpm6	UTSW	19	18815241	missense	probably benign	0.01
R7891:Trpm6	UTSW	19	18776710	missense	probably benign	0.01
R7955:Trpm6	UTSW	19	18854290	missense	probably benign	0.01
R7965:Trpm6	UTSW	19	18876110	missense	probably damaging	1.00
R7967:Trpm6	UTSW	19	18778659	missense	probably damaging	0.99
R7992:Trpm6	UTSW	19	18815350	missense	probably damaging	1.00
R8035:Trpm6	UTSW	19	18792862	missense	probably damaging	0.97
R8108:Trpm6	UTSW	19	18811790	missense	probably damaging	1.00
R8268:Trpm6	UTSW	19	18873861	missense	possibly damaging	0.85
R8411:Trpm6	UTSW	19	18853968	missense	probably benign	0.39
R8413:Trpm6	UTSW	19	18832485	missense	probably benign	0.00
R8534:Trpm6	UTSW	19	18892095	missense	probably benign	0.00
R8932:Trpm6	UTSW	19	18838002	missense	possibly damaging	0.87
R8990:Trpm6	UTSW	19	18815435	missense	probably damaging	1.00
R9403:Trpm6	UTSW	19	18832652	missense	possibly damaging	0.84
R9446:Trpm6	UTSW	19	18838098	missense	possibly damaging	0.91
R9463:Trpm6	UTSW	19	18783900	critical splice donor site	probably null
R9485:Trpm6	UTSW	19	18778614	missense	probably benign	0.06
R9536:Trpm6	UTSW	19	18786759	missense	probably damaging	1.00
R9549:Trpm6	UTSW	19	18876030	nonsense	probably null
R9626:Trpm6	UTSW	19	18813482	missense	probably damaging	1.00
R9655:Trpm6	UTSW	19	18892102	missense	probably benign
R9721:Trpm6	UTSW	19	18829972	missense	probably benign	0.12
R9742:Trpm6	UTSW	19	18823402	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- GATAGCCCCTTCATAGACCATG -3'
(R):5'- TGCTGCCCACAGTAGTTAAC -3'

Sequencing Primer
(F):5'- AGATATCCTTTTGATTTAAGGTGCAC -3'
(R):5'- GCTGCCCACAGTAGTTAACAATCTC -3'

Posted On

2022-08-09