Incidental Mutation 'R9564:Entpd7'
ID 721431
Institutional Source Beutler Lab
Gene Symbol Entpd7
Ensembl Gene ENSMUSG00000025192
Gene Name ectonucleoside triphosphate diphosphohydrolase 7
Synonyms 1810020C02Rik, 2810003F23Rik, 1810012B13Rik, LALP1, Lysal2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R9564 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 43689672-43733697 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43717450 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 237 (E237G)
Ref Sequence ENSEMBL: ENSMUSP00000079864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081079]
AlphaFold Q3TCT4
Predicted Effect probably benign
Transcript: ENSMUST00000081079
AA Change: E237G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000079864
Gene: ENSMUSG00000025192
AA Change: E237G

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
Pfam:GDA1_CD39 75 534 3.6e-106 PFAM
transmembrane domain 550 572 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for deletions in this gene have increased Th17 T cell levels in the lamina propria of the small intestine. They show increased resistance to Citrobacter rodentium infection and increased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 135 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,057,305 N176K possibly damaging Het
3110009E18Rik T A 1: 120,169,276 V134E Het
9130409I23Rik G T 1: 181,055,245 V191F possibly damaging Het
Abca8a T A 11: 110,074,184 H429L probably benign Het
Acsf2 T A 11: 94,573,065 I98F possibly damaging Het
Actr5 A G 2: 158,628,215 D255G probably damaging Het
Adam21 C T 12: 81,559,059 C643Y probably damaging Het
Adcy7 TGG TG 8: 88,326,425 probably null Het
AI429214 A G 8: 36,993,913 S72G possibly damaging Het
Akap13 T C 7: 75,609,413 V595A probably benign Het
Akt3 T C 1: 177,080,203 T209A possibly damaging Het
Alpk2 C T 18: 65,305,943 G793D probably damaging Het
Amotl1 T C 9: 14,562,217 K562R possibly damaging Het
Ankib1 T A 5: 3,755,733 N178I possibly damaging Het
Arfgef1 A T 1: 10,147,533 D1560E probably benign Het
Arhgap20 AAGAGAG AAGAG 9: 51,850,113 probably null Het
Arpc5l A G 2: 39,015,112 T152A probably benign Het
Asic3 C G 5: 24,415,877 D252E possibly damaging Het
Atf7 T A 15: 102,534,277 M466L probably benign Het
Bcl9l A G 9: 44,509,257 D1320G probably damaging Het
Bdkrb1 G A 12: 105,604,819 V215I probably benign Het
Brpf3 T G 17: 28,807,178 D408E probably benign Het
Btn2a2 C A 13: 23,478,678 K367N possibly damaging Het
Btnl10 T A 11: 58,922,363 F273I probably benign Het
C1qtnf12 C T 4: 155,965,016 T145I probably benign Het
Cacna1s T C 1: 136,118,778 C1763R probably benign Het
Ccdc154 C A 17: 25,168,407 Q372K possibly damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Celsr2 T C 3: 108,414,518 Y326C probably damaging Het
Cfap46 A T 7: 139,651,555 V914E Het
Coil T A 11: 88,981,800 V329E possibly damaging Het
Copb1 A G 7: 114,236,799 I449T possibly damaging Het
Copg1 T G 6: 87,892,701 S187R probably damaging Het
Cps1 T A 1: 67,158,889 F371Y probably benign Het
Cpt1b A T 15: 89,419,269 F554L probably damaging Het
Ctdsp2 A G 10: 126,996,171 D216G probably damaging Het
Ctla2b A T 13: 60,896,042 Y104* probably null Het
Cyp2j6 A G 4: 96,526,008 I340T probably damaging Het
Ddi1 T A 9: 6,265,730 D213V probably damaging Het
Dlgap1 T G 17: 70,657,463 N400K probably benign Het
Dnah5 G A 15: 28,290,276 V1271M probably benign Het
Dnah8 T A 17: 30,713,047 V1463E probably benign Het
Dstyk G A 1: 132,434,285 R151H probably damaging Het
Ehd3 T G 17: 73,830,366 V510G probably benign Het
Enthd1 G T 15: 80,560,034 Q107K probably damaging Het
Fadd A T 7: 144,582,311 C27S probably damaging Het
Fan1 A G 7: 64,349,492 L874P possibly damaging Het
Fbxw17 T C 13: 50,425,569 W141R probably damaging Het
Fig4 A G 10: 41,285,391 V63A probably benign Het
Fmo3 T C 1: 162,958,452 D323G probably damaging Het
Gas8 T A 8: 123,536,440 V452E possibly damaging Het
Gdf9 T A 11: 53,436,684 S156T probably damaging Het
Gm15922 C T 7: 3,739,647 V21M possibly damaging Het
Gm884 T C 11: 103,612,996 I2715M unknown Het
Hlcs T C 16: 94,134,721 S571G probably benign Het
Hmox2 A G 16: 4,765,006 Y201C probably damaging Het
Ikzf3 T A 11: 98,467,206 D435V probably damaging Het
Kank2 T C 9: 21,794,556 T389A possibly damaging Het
Kank2 A G 9: 21,795,335 L129P probably damaging Het
Kdr T A 5: 75,964,905 K339N probably benign Het
Lmntd2 A G 7: 141,210,788 S516P Het
Lrrc40 T A 3: 158,040,441 V51D probably benign Het
Lrrtm1 A G 6: 77,244,553 N331S probably benign Het
Lvrn T G 18: 46,884,439 I612S probably damaging Het
Map3k3 T A 11: 106,151,034 I413N probably damaging Het
Mcm9 C T 10: 53,630,008 A57T possibly damaging Het
Met T A 6: 17,531,426 F568I probably benign Het
Mkx A G 18: 7,002,457 F30L probably benign Het
Mrc1 A G 2: 14,261,306 N345S probably benign Het
Mstn T A 1: 53,064,208 N234K probably benign Het
Mtmr3 A T 11: 4,490,992 S554T possibly damaging Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Myh8 T C 11: 67,286,389 V427A probably benign Het
Nr4a2 A T 2: 57,110,178 I365N probably damaging Het
Nrxn2 A G 19: 6,509,857 D1215G probably damaging Het
Olfr709-ps1 A G 7: 106,926,640 M273T probably benign Het
Olfr820 T C 10: 130,017,418 I19T probably benign Het
Olfr830 G A 9: 18,875,344 V3I probably benign Het
Osbpl6 T A 2: 76,595,977 W967R probably damaging Het
Pcdhb21 T C 18: 37,513,919 S34P possibly damaging Het
Pibf1 G T 14: 99,137,174 D350Y possibly damaging Het
Plekhs1 A T 19: 56,473,196 I123F probably damaging Het
Pold2 C T 11: 5,874,163 G214D probably benign Het
Pomc A G 12: 3,959,971 T71A probably benign Het
Pot1b A G 17: 55,662,465 S568P possibly damaging Het
Prkd2 C A 7: 16,857,819 Q592K possibly damaging Het
Prss28 C T 17: 25,309,937 A84V probably damaging Het
Prtg T A 9: 72,858,871 Y649N probably damaging Het
Psip1 T C 4: 83,468,651 E161G possibly damaging Het
Rab3gap2 A G 1: 185,282,494 D1280G probably damaging Het
Rab3ip A T 10: 116,915,875 I329N probably damaging Het
Rarres2 C T 6: 48,572,230 G13D possibly damaging Het
Rbp3 A G 14: 33,955,520 D475G probably damaging Het
Ric3 A G 7: 109,038,811 V246A probably damaging Het
Robo3 A G 9: 37,429,604 F124S probably damaging Het
Rpl27a C A 7: 109,519,630 H17N probably benign Het
Rptn A G 3: 93,397,229 D623G probably benign Het
Rtl1 G T 12: 109,590,279 Q1709K probably benign Het
Sacs T A 14: 61,211,597 D3697E probably damaging Het
Sec61b A G 4: 47,483,049 Y93C probably damaging Het
Serpina3a A T 12: 104,118,627 I94L probably benign Het
Skiv2l C T 17: 34,844,782 A562T probably benign Het
Skor2 C T 18: 76,858,681 H33Y unknown Het
Slc12a3 G A 8: 94,356,355 V874I probably benign Het
Slit1 T A 19: 41,603,422 M1254L probably benign Het
Smg1 A G 7: 118,212,985 S52P unknown Het
Sorl1 A G 9: 42,046,597 Y584H probably damaging Het
Spata32 T A 11: 103,208,953 Q242L possibly damaging Het
Sptbn4 T G 7: 27,418,079 E415A probably damaging Het
St5 G T 7: 109,526,329 D980E probably damaging Het
St6galnac5 T C 3: 152,840,145 R259G probably damaging Het
Stat3 T C 11: 100,893,788 I589V probably benign Het
Tecta T A 9: 42,337,827 K1913M probably damaging Het
Tek C A 4: 94,873,935 N1103K probably damaging Het
Telo2 A G 17: 25,115,225 I16T probably benign Het
Tmem207 G T 16: 26,516,749 C79* probably null Het
Topaz1 C T 9: 122,750,154 H710Y probably benign Het
Trim33 T A 3: 103,331,649 S648T probably benign Het
Trpm6 A G 19: 18,873,876 T1734A possibly damaging Het
Trpm8 A G 1: 88,326,436 E127G possibly damaging Het
Ttc3 T A 16: 94,448,059 C1139S probably benign Het
Ttn T C 2: 76,749,986 E23521G probably damaging Het
Ush2a T C 1: 188,536,354 I1669T possibly damaging Het
Vcpip1 C A 1: 9,747,231 S309I possibly damaging Het
Vmn1r208 A G 13: 22,772,619 V236A probably damaging Het
Vmn1r74 T C 7: 11,847,607 F278S probably damaging Het
Vmn2r33 T C 7: 7,554,082 S540G probably benign Het
Vmn2r52 T C 7: 10,171,255 D219G probably benign Het
Wiz G T 17: 32,356,965 D812E probably benign Het
Ylpm1 C T 12: 85,044,402 P1787S probably benign Het
Zan T C 5: 137,406,426 E3858G unknown Het
Zfp760 T G 17: 21,723,291 H482Q possibly damaging Het
Zfp78 A G 7: 6,378,391 T147A probably benign Het
Zfp808 T A 13: 62,172,847 I630K possibly damaging Het
Zpld1 T A 16: 55,241,338 R227* probably null Het
Other mutations in Entpd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Entpd7 APN 19 43729839 missense probably benign 0.00
R0056:Entpd7 UTSW 19 43725294 missense probably benign 0.09
R0118:Entpd7 UTSW 19 43704312 nonsense probably null
R0639:Entpd7 UTSW 19 43691094 missense probably benign 0.42
R1479:Entpd7 UTSW 19 43721840 missense probably damaging 1.00
R1532:Entpd7 UTSW 19 43691077 missense possibly damaging 0.76
R1647:Entpd7 UTSW 19 43721745 splice site probably benign
R1689:Entpd7 UTSW 19 43725476 missense probably damaging 0.96
R2230:Entpd7 UTSW 19 43721816 missense probably benign 0.07
R2231:Entpd7 UTSW 19 43721816 missense probably benign 0.07
R2422:Entpd7 UTSW 19 43728088 missense possibly damaging 0.66
R3807:Entpd7 UTSW 19 43725540 critical splice donor site probably null
R3914:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R3949:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R4021:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R4022:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R4095:Entpd7 UTSW 19 43704201 missense probably damaging 1.00
R4737:Entpd7 UTSW 19 43691195 nonsense probably null
R5582:Entpd7 UTSW 19 43704994 missense probably damaging 1.00
R5653:Entpd7 UTSW 19 43691157 nonsense probably null
R5763:Entpd7 UTSW 19 43704266 missense probably damaging 1.00
R6508:Entpd7 UTSW 19 43691086 missense probably damaging 1.00
R7657:Entpd7 UTSW 19 43725467 missense possibly damaging 0.67
R8013:Entpd7 UTSW 19 43728055 missense probably benign 0.00
R8235:Entpd7 UTSW 19 43717545 missense probably damaging 1.00
R8880:Entpd7 UTSW 19 43704407 splice site probably benign
R9318:Entpd7 UTSW 19 43704270 missense possibly damaging 0.88
Z1176:Entpd7 UTSW 19 43725358 missense probably benign 0.43
Z1177:Entpd7 UTSW 19 43725497 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCTTTTACAGGATGGCTATG -3'
(R):5'- CCCCAAACTTCACATTGTGATC -3'

Sequencing Primer
(F):5'- ACAGGATGGCTATGTTGCTGACC -3'
(R):5'- TTCACCAGCACCGGCATTC -3'
Posted On 2022-08-09