Incidental Mutation 'R9565:Herc3'
ID 721468
Institutional Source Beutler Lab
Gene Symbol Herc3
Ensembl Gene ENSMUSG00000029804
Gene Name hect domain and RLD 3
Synonyms 5730409F18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9565 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 58831465-58920398 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58859014 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 280 (N280S)
Ref Sequence ENSEMBL: ENSMUSP00000040025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031823] [ENSMUST00000041401] [ENSMUST00000126292]
AlphaFold A6H6S0
Predicted Effect probably benign
Transcript: ENSMUST00000031823
AA Change: N280S

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000031823
Gene: ENSMUSG00000029804
AA Change: N280S

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 3.3e-11 PFAM
Pfam:RCC1 52 99 3.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 1.4e-16 PFAM
Pfam:RCC1_2 139 168 2.1e-9 PFAM
Pfam:RCC1 155 205 2.6e-16 PFAM
Pfam:RCC1_2 193 221 1.5e-9 PFAM
Pfam:RCC1 208 257 4.7e-17 PFAM
Pfam:RCC1_2 244 273 8e-9 PFAM
Pfam:RCC1 260 309 2.6e-16 PFAM
Pfam:RCC1_2 296 326 2.3e-7 PFAM
Pfam:RCC1 313 377 3.8e-9 PFAM
HECTc 721 913 2.08e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000041401
AA Change: N280S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000040025
Gene: ENSMUSG00000029804
AA Change: N280S

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 1.7e-11 PFAM
Pfam:RCC1 52 99 1.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 7.3e-16 PFAM
Pfam:RCC1_2 139 168 1.3e-9 PFAM
Pfam:RCC1 155 205 1.4e-16 PFAM
Pfam:RCC1_2 193 221 5e-10 PFAM
Pfam:RCC1 208 257 1.4e-16 PFAM
Pfam:RCC1_2 244 273 6.1e-8 PFAM
Pfam:RCC1 260 309 1.7e-14 PFAM
Pfam:RCC1_2 296 326 1.1e-7 PFAM
Pfam:RCC1 313 377 6.6e-11 PFAM
HECTc 721 1050 5.79e-157 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126292
SMART Domains Protein: ENSMUSP00000122401
Gene: ENSMUSG00000029804

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 1.5e-12 PFAM
Pfam:RCC1 52 77 1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member the HERC ubiquitin ligase family. The encoded protein is located in the cytosol and binds ubiquitin via a HECT domain. Mutations in this gene have been associated with colorectal and gastric carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hair follicle bulge morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,975 M303T probably benign Het
2310035C23Rik T C 1: 105,664,151 V15A probably damaging Het
4930402H24Rik G A 2: 130,806,791 T257M unknown Het
Aco2 G A 15: 81,889,434 R58Q probably null Het
Actl11 A T 9: 107,930,922 T815S possibly damaging Het
Actr5 A G 2: 158,628,215 D255G probably damaging Het
Acvr1 T C 2: 58,448,373 K446E probably damaging Het
Adam39 T C 8: 40,824,718 Y49H probably benign Het
Adcy7 TGG TG 8: 88,326,425 probably null Het
Amn1 C T 6: 149,188,605 probably benign Het
Ankdd1a C T 9: 65,504,170 A352T possibly damaging Het
Arl4c A G 1: 88,701,412 C85R probably damaging Het
Asgr2 T A 11: 70,105,484 probably null Het
Bdkrb1 G A 12: 105,604,819 V215I probably benign Het
Btn2a2 C A 13: 23,478,678 K367N possibly damaging Het
Btnl10 T A 11: 58,922,363 F273I probably benign Het
C7 T A 15: 5,057,097 probably null Het
Cap1 A G 4: 122,864,712 V225A probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc18 A G 5: 108,191,934 T782A probably damaging Het
Ccdc187 T C 2: 26,293,686 S101G possibly damaging Het
Ccdc30 T C 4: 119,393,624 N141S possibly damaging Het
Cdc42bpg T G 19: 6,320,666 L1263R probably damaging Het
Cdc42ep1 A T 15: 78,849,582 H294L probably benign Het
Cdk12 A G 11: 98,249,802 N1290D unknown Het
Ces1g A G 8: 93,335,164 V38A probably benign Het
Cntnap4 A C 8: 112,856,350 Y1020S probably benign Het
Col7a1 T C 9: 108,962,741 V1232A unknown Het
Ctdsp2 A G 10: 126,996,171 D216G probably damaging Het
Cyp2j6 A G 4: 96,526,008 I340T probably damaging Het
Cyp4f37 A G 17: 32,625,231 D103G possibly damaging Het
Dlgap1 T G 17: 70,657,463 N400K probably benign Het
Dnah1 C A 14: 31,264,437 A3698S probably damaging Het
Dnah12 C A 14: 26,875,324 R3547S possibly damaging Het
Dnah3 A G 7: 120,010,891 V1774A probably benign Het
Drc7 A G 8: 95,075,238 E709G probably damaging Het
Dsc1 T A 18: 20,107,734 D178V probably damaging Het
Duox1 T C 2: 122,320,722 Y293H probably damaging Het
Epas1 T A 17: 86,805,239 D88E probably damaging Het
Epdr1 A G 13: 19,594,651 F92L possibly damaging Het
Eri3 T A 4: 117,564,816 V136E probably benign Het
Espl1 T A 15: 102,319,798 I1669N possibly damaging Het
Etv6 A G 6: 134,248,709 N212S probably benign Het
Fam186b A T 15: 99,278,804 L735Q probably damaging Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fam208a T C 14: 27,479,809 probably null Het
Fam212a T A 9: 107,984,289 Y276F probably benign Het
Fan1 A G 7: 64,349,492 L874P possibly damaging Het
Fancm A G 12: 65,121,720 N1619S probably damaging Het
Fbln5 A T 12: 101,768,463 N183K probably damaging Het
Fbn2 T C 18: 58,095,226 H746R probably benign Het
Fbxw17 T C 13: 50,425,569 W141R probably damaging Het
Fbxw25 T A 9: 109,654,608 N179Y Het
Gbe1 A T 16: 70,401,776 Y119F probably benign Het
Gcnt7 T A 2: 172,451,260 Y369F probably damaging Het
Gdf9 T A 11: 53,436,684 S156T probably damaging Het
Gm11236 G T 4: 73,638,953 V8F probably damaging Het
Gm14295 T C 2: 176,807,369 V4A probably benign Het
Gm8369 A C 19: 11,511,651 T101P probably benign Het
Hipk2 T A 6: 38,747,455 R447W probably damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hltf G A 3: 20,082,832 probably null Het
Ik C A 18: 36,753,906 D397E probably benign Het
Ikbkap G T 4: 56,772,521 P867T probably benign Het
Kcnc1 G A 7: 46,427,586 V271M probably benign Het
Kif21b A T 1: 136,149,352 I371F probably damaging Het
Klrc1 A G 6: 129,678,783 F43S probably damaging Het
Krt8 A G 15: 102,004,025 V72A probably benign Het
Krtap6-2 A G 16: 89,419,834 S82P unknown Het
Lrrc15 G A 16: 30,274,198 L108F probably damaging Het
Lvrn T G 18: 46,884,439 I612S probably damaging Het
Map3k3 T A 11: 106,151,034 I413N probably damaging Het
Mark3 A G 12: 111,604,526 I87V probably damaging Het
Mki67 GTT GTTT 7: 135,707,504 probably null Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrgprb2 G A 7: 48,552,926 T17M possibly damaging Het
Myh3 C T 11: 67,092,361 R905* probably null Het
Myh8 T C 11: 67,286,389 V427A probably benign Het
Myocd T C 11: 65,187,383 K529E probably damaging Het
Myom2 A T 8: 15,108,399 K784* probably null Het
Olfr225 T G 11: 59,613,513 I183S probably damaging Het
Olfr365 G T 2: 37,201,563 M107I probably benign Het
Olfr820 T C 10: 130,017,418 I19T probably benign Het
Pabpc4 T C 4: 123,286,860 I125T probably damaging Het
Parp14 A G 16: 35,857,405 I731T probably benign Het
Pde6c T A 19: 38,158,560 probably null Het
Pias3 T A 3: 96,703,551 C391S possibly damaging Het
Pknox2 A T 9: 36,923,771 M134K probably damaging Het
Pot1b A G 17: 55,662,465 S568P possibly damaging Het
Ppp1r3a T A 6: 14,719,467 T483S probably benign Het
Rag1 A T 2: 101,642,982 V605E probably damaging Het
Ros1 T C 10: 52,067,074 D2048G probably damaging Het
Rp2 A G X: 20,377,542 D252G probably benign Het
Rpgrip1l A C 8: 91,304,888 H120Q probably benign Het
Rpl24 T A 16: 55,970,146 S122T probably benign Het
Sec61b A G 4: 47,483,049 Y93C probably damaging Het
Sema6a A T 18: 47,249,527 L651Q probably null Het
Serpinb6a T A 13: 33,918,417 K275I probably damaging Het
Skiv2l C T 17: 34,844,782 A562T probably benign Het
Skor2 C T 18: 76,858,681 H33Y unknown Het
Slc26a7 T C 4: 14,519,496 N508S probably benign Het
Slc2a4 A G 11: 69,946,347 F88L probably damaging Het
Slc8b1 A G 5: 120,527,800 T399A probably benign Het
Slfn5 A T 11: 82,956,873 M195L possibly damaging Het
Snx17 C A 5: 31,197,744 Q368K probably damaging Het
Tbcb A T 7: 30,231,124 probably null Het
Telo2 A G 17: 25,115,225 I16T probably benign Het
Timm50 A G 7: 28,307,644 F202S possibly damaging Het
Tle2 A G 10: 81,581,733 D244G probably benign Het
Tlr4 G A 4: 66,841,285 V772I possibly damaging Het
Tmem214 G A 5: 30,869,699 W11* probably null Het
Top2b A C 14: 16,365,718 T14P probably benign Het
Trim44 T C 2: 102,357,482 T309A probably benign Het
Tuba8 A G 6: 121,223,104 N249S probably benign Het
Tubb4a A G 17: 57,081,027 V333A probably benign Het
Ugdh C A 5: 65,418,533 D328Y possibly damaging Het
Vmn1r189 A G 13: 22,102,256 L137P probably damaging Het
Vmn1r208 A G 13: 22,772,619 V236A probably damaging Het
Vmn2r29 A T 7: 7,241,856 W340R probably benign Het
Vmn2r52 A C 7: 10,159,549 D554E probably benign Het
Wdr36 C T 18: 32,861,115 Q669* probably null Het
Wiz G T 17: 32,356,965 D812E probably benign Het
Zfp777 A T 6: 48,044,646 V14D possibly damaging Het
Other mutations in Herc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Herc3 APN 6 58874263 missense probably damaging 1.00
IGL00423:Herc3 APN 6 58868715 missense probably damaging 0.99
IGL00468:Herc3 APN 6 58918766 missense probably benign 0.04
IGL01153:Herc3 APN 6 58860336 missense probably benign 0.21
IGL01468:Herc3 APN 6 58854895 missense probably benign 0.00
IGL01696:Herc3 APN 6 58860386 missense possibly damaging 0.58
IGL01975:Herc3 APN 6 58916576 missense possibly damaging 0.91
IGL02797:Herc3 APN 6 58868694 missense probably benign
IGL02953:Herc3 APN 6 58857733 nonsense probably null
aegean UTSW 6 58855760 nonsense probably null
PIT4519001:Herc3 UTSW 6 58876811 missense probably damaging 1.00
R0019:Herc3 UTSW 6 58885065 splice site probably benign
R0019:Herc3 UTSW 6 58885065 splice site probably benign
R0025:Herc3 UTSW 6 58874308 missense probably damaging 1.00
R0025:Herc3 UTSW 6 58874308 missense probably damaging 1.00
R0268:Herc3 UTSW 6 58868628 splice site probably benign
R0334:Herc3 UTSW 6 58918817 missense probably damaging 1.00
R0344:Herc3 UTSW 6 58868628 splice site probably benign
R0853:Herc3 UTSW 6 58876564 missense probably damaging 1.00
R0927:Herc3 UTSW 6 58868763 missense possibly damaging 0.48
R1333:Herc3 UTSW 6 58887493 missense probably damaging 1.00
R1432:Herc3 UTSW 6 58916842 missense possibly damaging 0.49
R1450:Herc3 UTSW 6 58876515 nonsense probably null
R1594:Herc3 UTSW 6 58887584 unclassified probably benign
R1757:Herc3 UTSW 6 58916470 missense probably damaging 1.00
R1765:Herc3 UTSW 6 58888660 missense probably damaging 0.99
R1932:Herc3 UTSW 6 58876793 missense probably damaging 0.99
R1945:Herc3 UTSW 6 58887439 missense probably damaging 0.96
R1988:Herc3 UTSW 6 58884975 critical splice donor site probably null
R2172:Herc3 UTSW 6 58887437 missense probably damaging 1.00
R3080:Herc3 UTSW 6 58856646 splice site probably null
R3545:Herc3 UTSW 6 58856685 missense probably damaging 1.00
R3767:Herc3 UTSW 6 58862988 missense probably benign
R3767:Herc3 UTSW 6 58876602 missense probably benign 0.00
R3805:Herc3 UTSW 6 58916850 missense probably damaging 1.00
R3806:Herc3 UTSW 6 58916850 missense probably damaging 1.00
R4049:Herc3 UTSW 6 58876837 missense probably damaging 0.99
R4250:Herc3 UTSW 6 58916516 missense probably damaging 1.00
R4469:Herc3 UTSW 6 58876809 nonsense probably null
R4534:Herc3 UTSW 6 58860347 missense probably benign
R4573:Herc3 UTSW 6 58894113 missense possibly damaging 0.89
R4887:Herc3 UTSW 6 58887499 missense probably damaging 1.00
R5047:Herc3 UTSW 6 58855760 nonsense probably null
R5049:Herc3 UTSW 6 58894539 splice site probably null
R5062:Herc3 UTSW 6 58855760 nonsense probably null
R5063:Herc3 UTSW 6 58855760 nonsense probably null
R5288:Herc3 UTSW 6 58874278 missense probably damaging 0.99
R5297:Herc3 UTSW 6 58856641 missense probably damaging 1.00
R5386:Herc3 UTSW 6 58874278 missense probably damaging 0.99
R5435:Herc3 UTSW 6 58855806 missense probably damaging 1.00
R5576:Herc3 UTSW 6 58888725 missense probably benign 0.08
R5605:Herc3 UTSW 6 58857727 missense probably damaging 1.00
R5719:Herc3 UTSW 6 58894543 missense possibly damaging 0.67
R5743:Herc3 UTSW 6 58918799 missense probably benign 0.12
R5870:Herc3 UTSW 6 58916450 missense probably benign 0.01
R6460:Herc3 UTSW 6 58890123 missense probably damaging 1.00
R6930:Herc3 UTSW 6 58916459 missense probably damaging 0.98
R7034:Herc3 UTSW 6 58876855 missense probably benign 0.00
R7131:Herc3 UTSW 6 58887424 missense probably damaging 1.00
R7187:Herc3 UTSW 6 58856631 missense probably benign 0.42
R7212:Herc3 UTSW 6 58918773 missense probably damaging 1.00
R7335:Herc3 UTSW 6 58876788 missense possibly damaging 0.95
R7349:Herc3 UTSW 6 58858986 missense probably benign
R7568:Herc3 UTSW 6 58843810 missense probably benign 0.01
R7857:Herc3 UTSW 6 58843652 nonsense probably null
R8321:Herc3 UTSW 6 58843769 missense possibly damaging 0.93
R8672:Herc3 UTSW 6 58873801 missense probably damaging 0.96
R8684:Herc3 UTSW 6 58887576 missense probably damaging 1.00
R8968:Herc3 UTSW 6 58890198 missense probably damaging 1.00
R8994:Herc3 UTSW 6 58874343 missense probably benign 0.11
R9219:Herc3 UTSW 6 58894567 missense probably benign 0.01
R9434:Herc3 UTSW 6 58876861 missense probably benign 0.00
R9562:Herc3 UTSW 6 58859014 missense probably null 0.01
Z1176:Herc3 UTSW 6 58843858 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCCTAAAGCTGTAGTCTTACATTC -3'
(R):5'- AATGGCAGTGGCTCAGTGAG -3'

Sequencing Primer
(F):5'- ACGGTCATCAGGTGAGTGTAATACC -3'
(R):5'- TGCCACAAGCAATCTGAG -3'
Posted On 2022-08-09