Incidental Mutation 'R9565:Top2b'
ID 721521
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Name topoisomerase (DNA) II beta
Synonyms D230016L12Rik, Top-2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock # R9565 (G1)
Quality Score 147.008
Status Not validated
Chromosome 14
Chromosomal Location 16365179-16435462 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 16365718 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 14 (T14P)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629]
AlphaFold Q64511
Predicted Effect probably benign
Transcript: ENSMUST00000017629
AA Change: T14P

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: T14P

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,975 M303T probably benign Het
2310035C23Rik T C 1: 105,664,151 V15A probably damaging Het
4930402H24Rik G A 2: 130,806,791 T257M unknown Het
Aco2 G A 15: 81,889,434 R58Q probably null Het
Actl11 A T 9: 107,930,922 T815S possibly damaging Het
Actr5 A G 2: 158,628,215 D255G probably damaging Het
Acvr1 T C 2: 58,448,373 K446E probably damaging Het
Adam39 T C 8: 40,824,718 Y49H probably benign Het
Adcy7 TGG TG 8: 88,326,425 probably null Het
Amn1 C T 6: 149,188,605 probably benign Het
Ankdd1a C T 9: 65,504,170 A352T possibly damaging Het
Arl4c A G 1: 88,701,412 C85R probably damaging Het
Asgr2 T A 11: 70,105,484 probably null Het
Bdkrb1 G A 12: 105,604,819 V215I probably benign Het
Btn2a2 C A 13: 23,478,678 K367N possibly damaging Het
Btnl10 T A 11: 58,922,363 F273I probably benign Het
C7 T A 15: 5,057,097 probably null Het
Cap1 A G 4: 122,864,712 V225A probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc18 A G 5: 108,191,934 T782A probably damaging Het
Ccdc187 T C 2: 26,293,686 S101G possibly damaging Het
Ccdc30 T C 4: 119,393,624 N141S possibly damaging Het
Cdc42bpg T G 19: 6,320,666 L1263R probably damaging Het
Cdc42ep1 A T 15: 78,849,582 H294L probably benign Het
Cdk12 A G 11: 98,249,802 N1290D unknown Het
Ces1g A G 8: 93,335,164 V38A probably benign Het
Cntnap4 A C 8: 112,856,350 Y1020S probably benign Het
Col7a1 T C 9: 108,962,741 V1232A unknown Het
Ctdsp2 A G 10: 126,996,171 D216G probably damaging Het
Cyp2j6 A G 4: 96,526,008 I340T probably damaging Het
Cyp4f37 A G 17: 32,625,231 D103G possibly damaging Het
Dlgap1 T G 17: 70,657,463 N400K probably benign Het
Dnah1 C A 14: 31,264,437 A3698S probably damaging Het
Dnah12 C A 14: 26,875,324 R3547S possibly damaging Het
Dnah3 A G 7: 120,010,891 V1774A probably benign Het
Drc7 A G 8: 95,075,238 E709G probably damaging Het
Dsc1 T A 18: 20,107,734 D178V probably damaging Het
Duox1 T C 2: 122,320,722 Y293H probably damaging Het
Epas1 T A 17: 86,805,239 D88E probably damaging Het
Epdr1 A G 13: 19,594,651 F92L possibly damaging Het
Eri3 T A 4: 117,564,816 V136E probably benign Het
Espl1 T A 15: 102,319,798 I1669N possibly damaging Het
Etv6 A G 6: 134,248,709 N212S probably benign Het
Fam186b A T 15: 99,278,804 L735Q probably damaging Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fam208a T C 14: 27,479,809 probably null Het
Fam212a T A 9: 107,984,289 Y276F probably benign Het
Fan1 A G 7: 64,349,492 L874P possibly damaging Het
Fancm A G 12: 65,121,720 N1619S probably damaging Het
Fbln5 A T 12: 101,768,463 N183K probably damaging Het
Fbn2 T C 18: 58,095,226 H746R probably benign Het
Fbxw17 T C 13: 50,425,569 W141R probably damaging Het
Fbxw25 T A 9: 109,654,608 N179Y Het
Gbe1 A T 16: 70,401,776 Y119F probably benign Het
Gcnt7 T A 2: 172,451,260 Y369F probably damaging Het
Gdf9 T A 11: 53,436,684 S156T probably damaging Het
Gm11236 G T 4: 73,638,953 V8F probably damaging Het
Gm14295 T C 2: 176,807,369 V4A probably benign Het
Gm8369 A C 19: 11,511,651 T101P probably benign Het
Herc3 A G 6: 58,859,014 N280S probably null Het
Hipk2 T A 6: 38,747,455 R447W probably damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hltf G A 3: 20,082,832 probably null Het
Ik C A 18: 36,753,906 D397E probably benign Het
Ikbkap G T 4: 56,772,521 P867T probably benign Het
Kcnc1 G A 7: 46,427,586 V271M probably benign Het
Kif21b A T 1: 136,149,352 I371F probably damaging Het
Klrc1 A G 6: 129,678,783 F43S probably damaging Het
Krt8 A G 15: 102,004,025 V72A probably benign Het
Krtap6-2 A G 16: 89,419,834 S82P unknown Het
Lrrc15 G A 16: 30,274,198 L108F probably damaging Het
Lvrn T G 18: 46,884,439 I612S probably damaging Het
Map3k3 T A 11: 106,151,034 I413N probably damaging Het
Mark3 A G 12: 111,604,526 I87V probably damaging Het
Mki67 GTT GTTT 7: 135,707,504 probably null Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrgprb2 G A 7: 48,552,926 T17M possibly damaging Het
Myh3 C T 11: 67,092,361 R905* probably null Het
Myh8 T C 11: 67,286,389 V427A probably benign Het
Myocd T C 11: 65,187,383 K529E probably damaging Het
Myom2 A T 8: 15,108,399 K784* probably null Het
Olfr225 T G 11: 59,613,513 I183S probably damaging Het
Olfr365 G T 2: 37,201,563 M107I probably benign Het
Olfr820 T C 10: 130,017,418 I19T probably benign Het
Pabpc4 T C 4: 123,286,860 I125T probably damaging Het
Parp14 A G 16: 35,857,405 I731T probably benign Het
Pde6c T A 19: 38,158,560 probably null Het
Pias3 T A 3: 96,703,551 C391S possibly damaging Het
Pknox2 A T 9: 36,923,771 M134K probably damaging Het
Pot1b A G 17: 55,662,465 S568P possibly damaging Het
Ppp1r3a T A 6: 14,719,467 T483S probably benign Het
Rag1 A T 2: 101,642,982 V605E probably damaging Het
Ros1 T C 10: 52,067,074 D2048G probably damaging Het
Rp2 A G X: 20,377,542 D252G probably benign Het
Rpgrip1l A C 8: 91,304,888 H120Q probably benign Het
Rpl24 T A 16: 55,970,146 S122T probably benign Het
Sec61b A G 4: 47,483,049 Y93C probably damaging Het
Sema6a A T 18: 47,249,527 L651Q probably null Het
Serpinb6a T A 13: 33,918,417 K275I probably damaging Het
Skiv2l C T 17: 34,844,782 A562T probably benign Het
Skor2 C T 18: 76,858,681 H33Y unknown Het
Slc26a7 T C 4: 14,519,496 N508S probably benign Het
Slc2a4 A G 11: 69,946,347 F88L probably damaging Het
Slc8b1 A G 5: 120,527,800 T399A probably benign Het
Slfn5 A T 11: 82,956,873 M195L possibly damaging Het
Snx17 C A 5: 31,197,744 Q368K probably damaging Het
Tbcb A T 7: 30,231,124 probably null Het
Telo2 A G 17: 25,115,225 I16T probably benign Het
Timm50 A G 7: 28,307,644 F202S possibly damaging Het
Tle2 A G 10: 81,581,733 D244G probably benign Het
Tlr4 G A 4: 66,841,285 V772I possibly damaging Het
Tmem214 G A 5: 30,869,699 W11* probably null Het
Trim44 T C 2: 102,357,482 T309A probably benign Het
Tuba8 A G 6: 121,223,104 N249S probably benign Het
Tubb4a A G 17: 57,081,027 V333A probably benign Het
Ugdh C A 5: 65,418,533 D328Y possibly damaging Het
Vmn1r189 A G 13: 22,102,256 L137P probably damaging Het
Vmn1r208 A G 13: 22,772,619 V236A probably damaging Het
Vmn2r29 A T 7: 7,241,856 W340R probably benign Het
Vmn2r52 A C 7: 10,159,549 D554E probably benign Het
Wdr36 C T 18: 32,861,115 Q669* probably null Het
Wiz G T 17: 32,356,965 D812E probably benign Het
Zfp777 A T 6: 48,044,646 V14D possibly damaging Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16422692 missense probably benign 0.00
IGL00730:Top2b APN 14 16389831 missense probably damaging 1.00
IGL00917:Top2b APN 14 16407354 missense probably benign 0.05
IGL01959:Top2b APN 14 16422695 missense probably benign 0.19
IGL02019:Top2b APN 14 16409965 missense probably benign 0.44
IGL02119:Top2b APN 14 16406733 missense probably damaging 1.00
IGL02136:Top2b APN 14 16407103 unclassified probably benign
IGL02148:Top2b APN 14 16400488 missense probably damaging 1.00
IGL02496:Top2b APN 14 16387335 missense probably benign
IGL02503:Top2b APN 14 16407163 missense possibly damaging 0.92
IGL02672:Top2b APN 14 16409166 unclassified probably benign
IGL02721:Top2b APN 14 16409236 missense probably damaging 1.00
IGL02886:Top2b APN 14 16365688 missense possibly damaging 0.73
IGL03252:Top2b APN 14 16393163 missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16423780 critical splice donor site probably null
R0092:Top2b UTSW 14 16409263 missense probably damaging 1.00
R0201:Top2b UTSW 14 16383174 missense probably damaging 1.00
R0390:Top2b UTSW 14 16418442 missense probably benign 0.00
R0394:Top2b UTSW 14 16413556 splice site probably null
R1159:Top2b UTSW 14 16430329 missense possibly damaging 0.81
R1424:Top2b UTSW 14 16383177 missense probably damaging 1.00
R1519:Top2b UTSW 14 16408953 splice site probably null
R1561:Top2b UTSW 14 16398993 missense possibly damaging 0.80
R1713:Top2b UTSW 14 16409823 missense probably benign 0.05
R1987:Top2b UTSW 14 16398916 missense probably damaging 0.99
R2219:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2287:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2422:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2679:Top2b UTSW 14 16413947 missense probably damaging 1.00
R3687:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3707:Top2b UTSW 14 16388447 missense probably damaging 1.00
R3810:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3812:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3815:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3816:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3818:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4023:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4025:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4026:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4133:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4157:Top2b UTSW 14 16384491 missense probably benign 0.42
R4179:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4180:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4300:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4376:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4377:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4492:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4549:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4550:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4581:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4582:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4628:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4630:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4667:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4668:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4669:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4698:Top2b UTSW 14 16387331 nonsense probably null
R4769:Top2b UTSW 14 16398991 missense probably damaging 1.00
R4809:Top2b UTSW 14 16383125 missense probably benign 0.06
R4899:Top2b UTSW 14 16387313 missense probably damaging 1.00
R5035:Top2b UTSW 14 16409966 missense probably benign 0.01
R5621:Top2b UTSW 14 16387280 missense probably damaging 1.00
R5631:Top2b UTSW 14 16409882 missense probably damaging 1.00
R5685:Top2b UTSW 14 16413666 missense probably damaging 1.00
R5732:Top2b UTSW 14 16400106 missense possibly damaging 0.92
R5939:Top2b UTSW 14 16422786 missense probably damaging 0.96
R6007:Top2b UTSW 14 16423779 critical splice donor site probably null
R6087:Top2b UTSW 14 16409864 missense probably benign 0.14
R6144:Top2b UTSW 14 16423740 missense possibly damaging 0.48
R6196:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6218:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6229:Top2b UTSW 14 16409838 missense probably damaging 1.00
R6249:Top2b UTSW 14 16399006 missense probably damaging 1.00
R6337:Top2b UTSW 14 16399026 missense possibly damaging 0.77
R6353:Top2b UTSW 14 16416671 missense probably damaging 1.00
R6512:Top2b UTSW 14 16409854 missense possibly damaging 0.94
R6573:Top2b UTSW 14 16398991 missense probably damaging 1.00
R6614:Top2b UTSW 14 16407142 nonsense probably null
R6844:Top2b UTSW 14 16429383 missense possibly damaging 0.94
R6848:Top2b UTSW 14 16409958 missense possibly damaging 0.89
R6871:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6895:Top2b UTSW 14 16413604 missense probably benign 0.06
R7162:Top2b UTSW 14 16416653 missense probably benign 0.00
R7247:Top2b UTSW 14 16416962 missense probably benign 0.08
R7250:Top2b UTSW 14 16420411 missense probably benign
R7359:Top2b UTSW 14 16407376 missense probably null 1.00
R7365:Top2b UTSW 14 16416649 missense probably benign 0.04
R7493:Top2b UTSW 14 16416605 missense probably benign 0.00
R7528:Top2b UTSW 14 16395427 nonsense probably null
R7562:Top2b UTSW 14 16412946 missense probably benign 0.04
R7594:Top2b UTSW 14 16428587 missense probably benign
R7670:Top2b UTSW 14 16416620 missense possibly damaging 0.61
R7894:Top2b UTSW 14 16413081 missense possibly damaging 0.68
R8031:Top2b UTSW 14 16412986 missense probably damaging 0.98
R8150:Top2b UTSW 14 16393291 missense probably damaging 0.99
R8214:Top2b UTSW 14 16383177 missense probably damaging 1.00
R8299:Top2b UTSW 14 16386123 missense possibly damaging 0.68
R8977:Top2b UTSW 14 16393239 missense probably benign 0.36
R9562:Top2b UTSW 14 16365718 missense probably benign 0.09
X0028:Top2b UTSW 14 16384499 nonsense probably null
Z1176:Top2b UTSW 14 16395434 missense probably damaging 1.00
Z1177:Top2b UTSW 14 16416953 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGTCCTCGACCACTCTGTAGG -3'
(R):5'- TGAGCATTGTTCAGCAGCC -3'

Sequencing Primer
(F):5'- CGCGCTCGAGTTTGAGG -3'
(R):5'- TCAGCAGCCTGAGCCTTG -3'
Posted On 2022-08-09