Incidental Mutation 'R9565:Dnah12'
ID 721522
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Name dynein, axonemal, heavy chain 12
Synonyms HL19, DHC3, Dnahc7l, 4921531P07Rik, HL-19, LOC380889, Hdhc3, Dnahc12, DLP12
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.187) question?
Stock # R9565 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 26414429-26613660 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 26597281 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 3547 (R3547S)
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000022433
AA Change: R3547S

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: R3547S

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 G A 15: 81,773,635 (GRCm39) R58Q probably null Het
Actl11 A T 9: 107,808,121 (GRCm39) T815S possibly damaging Het
Actr5 A G 2: 158,470,135 (GRCm39) D255G probably damaging Het
Acvr1 T C 2: 58,338,385 (GRCm39) K446E probably damaging Het
Adam39 T C 8: 41,277,755 (GRCm39) Y49H probably benign Het
Adcy7 TGG TG 8: 89,053,053 (GRCm39) probably null Het
Amn1 C T 6: 149,090,103 (GRCm39) probably benign Het
Ankdd1a C T 9: 65,411,452 (GRCm39) A352T possibly damaging Het
Aoc1l2 T C 6: 48,907,909 (GRCm39) M303T probably benign Het
Arl4c A G 1: 88,629,134 (GRCm39) C85R probably damaging Het
Asgr2 T A 11: 69,996,310 (GRCm39) probably null Het
Bdkrb1 G A 12: 105,571,078 (GRCm39) V215I probably benign Het
Btn2a2 C A 13: 23,662,848 (GRCm39) K367N possibly damaging Het
Btnl10 T A 11: 58,813,189 (GRCm39) F273I probably benign Het
C7 T A 15: 5,086,579 (GRCm39) probably null Het
Cap1 A G 4: 122,758,505 (GRCm39) V225A probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,128,173 (GRCm39) probably benign Het
Ccdc18 A G 5: 108,339,800 (GRCm39) T782A probably damaging Het
Ccdc187 T C 2: 26,183,698 (GRCm39) S101G possibly damaging Het
Ccdc30 T C 4: 119,250,821 (GRCm39) N141S possibly damaging Het
Cdc42bpg T G 19: 6,370,696 (GRCm39) L1263R probably damaging Het
Cdc42ep1 A T 15: 78,733,782 (GRCm39) H294L probably benign Het
Cdk12 A G 11: 98,140,628 (GRCm39) N1290D unknown Het
Ces1g A G 8: 94,061,792 (GRCm39) V38A probably benign Het
Cntnap4 A C 8: 113,582,982 (GRCm39) Y1020S probably benign Het
Col7a1 T C 9: 108,791,809 (GRCm39) V1232A unknown Het
Ctdsp2 A G 10: 126,832,040 (GRCm39) D216G probably damaging Het
Cyp2j6 A G 4: 96,414,245 (GRCm39) I340T probably damaging Het
Cyp4f37 A G 17: 32,844,205 (GRCm39) D103G possibly damaging Het
Dlgap1 T G 17: 70,964,458 (GRCm39) N400K probably benign Het
Dnaaf9 G A 2: 130,648,711 (GRCm39) T257M unknown Het
Dnah1 C A 14: 30,986,394 (GRCm39) A3698S probably damaging Het
Dnah3 A G 7: 119,610,114 (GRCm39) V1774A probably benign Het
Drc7 A G 8: 95,801,866 (GRCm39) E709G probably damaging Het
Dsc1 T A 18: 20,240,791 (GRCm39) D178V probably damaging Het
Duox1 T C 2: 122,151,203 (GRCm39) Y293H probably damaging Het
Elp1 G T 4: 56,772,521 (GRCm39) P867T probably benign Het
Epas1 T A 17: 87,112,667 (GRCm39) D88E probably damaging Het
Epdr1 A G 13: 19,778,821 (GRCm39) F92L possibly damaging Het
Eri3 T A 4: 117,422,013 (GRCm39) V136E probably benign Het
Espl1 T A 15: 102,228,233 (GRCm39) I1669N possibly damaging Het
Etv6 A G 6: 134,225,672 (GRCm39) N212S probably benign Het
Fam186b A T 15: 99,176,685 (GRCm39) L735Q probably damaging Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Fan1 A G 7: 63,999,240 (GRCm39) L874P possibly damaging Het
Fancm A G 12: 65,168,494 (GRCm39) N1619S probably damaging Het
Fbln5 A T 12: 101,734,722 (GRCm39) N183K probably damaging Het
Fbn2 T C 18: 58,228,298 (GRCm39) H746R probably benign Het
Fbxw17 T C 13: 50,579,605 (GRCm39) W141R probably damaging Het
Fbxw25 T A 9: 109,483,676 (GRCm39) N179Y Het
Gbe1 A T 16: 70,198,664 (GRCm39) Y119F probably benign Het
Gcnt7 T A 2: 172,293,180 (GRCm39) Y369F probably damaging Het
Gdf9 T A 11: 53,327,511 (GRCm39) S156T probably damaging Het
Gm14295 T C 2: 176,499,162 (GRCm39) V4A probably benign Het
Gm8369 A C 19: 11,489,015 (GRCm39) T101P probably benign Het
Herc3 A G 6: 58,835,999 (GRCm39) N280S probably null Het
Hipk2 T A 6: 38,724,390 (GRCm39) R447W probably damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,194,000 (GRCm39) probably benign Het
Hltf G A 3: 20,136,996 (GRCm39) probably null Het
Ik C A 18: 36,886,959 (GRCm39) D397E probably benign Het
Inka1 T A 9: 107,861,488 (GRCm39) Y276F probably benign Het
Kcnc1 G A 7: 46,077,010 (GRCm39) V271M probably benign Het
Kif21b A T 1: 136,077,090 (GRCm39) I371F probably damaging Het
Klrc1 A G 6: 129,655,746 (GRCm39) F43S probably damaging Het
Krt8 A G 15: 101,912,460 (GRCm39) V72A probably benign Het
Krtap6-2 A G 16: 89,216,722 (GRCm39) S82P unknown Het
Lrrc15 G A 16: 30,093,016 (GRCm39) L108F probably damaging Het
Lvrn T G 18: 47,017,506 (GRCm39) I612S probably damaging Het
Map3k3 T A 11: 106,041,860 (GRCm39) I413N probably damaging Het
Mark3 A G 12: 111,570,960 (GRCm39) I87V probably damaging Het
Mki67 GTT GTTT 7: 135,309,233 (GRCm39) probably null Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mrgprb2 G A 7: 48,202,674 (GRCm39) T17M possibly damaging Het
Msantd5f4 G T 4: 73,557,190 (GRCm39) V8F probably damaging Het
Myh3 C T 11: 66,983,187 (GRCm39) R905* probably null Het
Myh8 T C 11: 67,177,215 (GRCm39) V427A probably benign Het
Myocd T C 11: 65,078,209 (GRCm39) K529E probably damaging Het
Myom2 A T 8: 15,158,399 (GRCm39) K784* probably null Het
Or1l4 G T 2: 37,091,575 (GRCm39) M107I probably benign Het
Or2w25 T G 11: 59,504,339 (GRCm39) I183S probably damaging Het
Or6c33 T C 10: 129,853,287 (GRCm39) I19T probably benign Het
Pabpc4 T C 4: 123,180,653 (GRCm39) I125T probably damaging Het
Parp14 A G 16: 35,677,775 (GRCm39) I731T probably benign Het
Pde6c T A 19: 38,147,008 (GRCm39) probably null Het
Pias3 T A 3: 96,610,867 (GRCm39) C391S possibly damaging Het
Pknox2 A T 9: 36,835,067 (GRCm39) M134K probably damaging Het
Pot1b A G 17: 55,969,465 (GRCm39) S568P possibly damaging Het
Ppp1r3a T A 6: 14,719,466 (GRCm39) T483S probably benign Het
Rag1 A T 2: 101,473,327 (GRCm39) V605E probably damaging Het
Relch T C 1: 105,591,876 (GRCm39) V15A probably damaging Het
Ros1 T C 10: 51,943,170 (GRCm39) D2048G probably damaging Het
Rp2 A G X: 20,243,781 (GRCm39) D252G probably benign Het
Rpgrip1l A C 8: 92,031,516 (GRCm39) H120Q probably benign Het
Rpl24 T A 16: 55,790,509 (GRCm39) S122T probably benign Het
Sec61b A G 4: 47,483,049 (GRCm39) Y93C probably damaging Het
Sema6a A T 18: 47,382,594 (GRCm39) L651Q probably null Het
Serpinb6a T A 13: 34,102,400 (GRCm39) K275I probably damaging Het
Skic2 C T 17: 35,063,758 (GRCm39) A562T probably benign Het
Skor2 C T 18: 76,946,376 (GRCm39) H33Y unknown Het
Slc26a7 T C 4: 14,519,496 (GRCm39) N508S probably benign Het
Slc2a4 A G 11: 69,837,173 (GRCm39) F88L probably damaging Het
Slc8b1 A G 5: 120,665,865 (GRCm39) T399A probably benign Het
Slfn5 A T 11: 82,847,699 (GRCm39) M195L possibly damaging Het
Snx17 C A 5: 31,355,088 (GRCm39) Q368K probably damaging Het
Tasor T C 14: 27,201,766 (GRCm39) probably null Het
Tbcb A T 7: 29,930,549 (GRCm39) probably null Het
Telo2 A G 17: 25,334,199 (GRCm39) I16T probably benign Het
Timm50 A G 7: 28,007,069 (GRCm39) F202S possibly damaging Het
Tle2 A G 10: 81,417,567 (GRCm39) D244G probably benign Het
Tlr4 G A 4: 66,759,522 (GRCm39) V772I possibly damaging Het
Tmem214 G A 5: 31,027,043 (GRCm39) W11* probably null Het
Top2b A C 14: 16,365,718 (GRCm38) T14P probably benign Het
Trim44 T C 2: 102,187,827 (GRCm39) T309A probably benign Het
Tuba8 A G 6: 121,200,063 (GRCm39) N249S probably benign Het
Tubb4a A G 17: 57,388,027 (GRCm39) V333A probably benign Het
Ugdh C A 5: 65,575,876 (GRCm39) D328Y possibly damaging Het
Vmn1r189 A G 13: 22,286,426 (GRCm39) L137P probably damaging Het
Vmn1r208 A G 13: 22,956,789 (GRCm39) V236A probably damaging Het
Vmn2r29 A T 7: 7,244,855 (GRCm39) W340R probably benign Het
Vmn2r52 A C 7: 9,893,476 (GRCm39) D554E probably benign Het
Wdr36 C T 18: 32,994,168 (GRCm39) Q669* probably null Het
Wiz G T 17: 32,575,939 (GRCm39) D812E probably benign Het
Zfp777 A T 6: 48,021,580 (GRCm39) V14D possibly damaging Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26,492,962 (GRCm39) missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26,431,430 (GRCm39) splice site probably benign
IGL01681:Dnah12 APN 14 26,443,315 (GRCm39) missense probably benign
IGL02082:Dnah12 APN 14 26,428,317 (GRCm39) missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26,437,732 (GRCm39) missense probably benign 0.20
IGL02170:Dnah12 APN 14 26,495,069 (GRCm39) missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26,428,072 (GRCm39) missense probably benign 0.00
IGL02367:Dnah12 APN 14 26,430,316 (GRCm39) missense probably benign 0.30
IGL02418:Dnah12 APN 14 26,495,679 (GRCm39) missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26,445,667 (GRCm39) missense probably benign 0.02
IGL03066:Dnah12 APN 14 26,418,553 (GRCm39) missense probably benign 0.06
drippings UTSW 14 26,576,761 (GRCm39) missense probably damaging 1.00
grueben UTSW 14 26,600,036 (GRCm39) missense probably damaging 1.00
BB010:Dnah12 UTSW 14 26,488,072 (GRCm39) missense probably benign 0.00
BB020:Dnah12 UTSW 14 26,488,072 (GRCm39) missense probably benign 0.00
F5770:Dnah12 UTSW 14 26,495,050 (GRCm39) missense possibly damaging 0.95
FR4304:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
FR4340:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26,594,697 (GRCm39) missense probably damaging 1.00
LCD18:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26,494,601 (GRCm39) missense probably damaging 1.00
R0110:Dnah12 UTSW 14 26,520,856 (GRCm39) missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26,521,956 (GRCm39) missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26,427,272 (GRCm39) splice site probably null
R0364:Dnah12 UTSW 14 26,445,628 (GRCm39) missense probably benign 0.10
R0469:Dnah12 UTSW 14 26,520,856 (GRCm39) missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26,430,465 (GRCm39) missense probably benign 0.00
R0709:Dnah12 UTSW 14 26,606,222 (GRCm39) splice site probably benign
R0734:Dnah12 UTSW 14 26,521,970 (GRCm39) missense probably benign 0.00
R1273:Dnah12 UTSW 14 26,460,375 (GRCm39) nonsense probably null
R1496:Dnah12 UTSW 14 26,431,403 (GRCm39) missense probably benign
R1503:Dnah12 UTSW 14 26,495,649 (GRCm39) missense probably damaging 1.00
R1535:Dnah12 UTSW 14 26,538,279 (GRCm39) missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26,488,147 (GRCm39) missense probably damaging 1.00
R1682:Dnah12 UTSW 14 26,500,840 (GRCm39) missense possibly damaging 0.71
R1758:Dnah12 UTSW 14 26,488,071 (GRCm39) missense probably benign 0.02
R1826:Dnah12 UTSW 14 26,432,174 (GRCm39) missense probably benign 0.01
R1829:Dnah12 UTSW 14 26,522,032 (GRCm39) missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26,494,980 (GRCm39) missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26,430,412 (GRCm39) missense probably benign 0.30
R1862:Dnah12 UTSW 14 26,418,553 (GRCm39) missense probably benign 0.06
R1913:Dnah12 UTSW 14 26,514,221 (GRCm39) splice site probably null
R1933:Dnah12 UTSW 14 26,455,650 (GRCm39) missense probably damaging 0.98
R2006:Dnah12 UTSW 14 26,536,416 (GRCm39) missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26,503,485 (GRCm39) missense probably null 1.00
R2113:Dnah12 UTSW 14 26,488,098 (GRCm39) missense probably damaging 1.00
R2125:Dnah12 UTSW 14 26,445,613 (GRCm39) nonsense probably null
R2126:Dnah12 UTSW 14 26,445,613 (GRCm39) nonsense probably null
R2207:Dnah12 UTSW 14 26,503,744 (GRCm39) missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26,460,485 (GRCm39) missense probably benign 0.06
R2511:Dnah12 UTSW 14 26,491,907 (GRCm39) missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26,598,907 (GRCm39) missense probably benign 0.05
R2875:Dnah12 UTSW 14 26,414,625 (GRCm39) missense probably benign 0.04
R3551:Dnah12 UTSW 14 26,492,929 (GRCm39) missense probably benign 0.01
R3713:Dnah12 UTSW 14 26,534,747 (GRCm39) missense probably benign
R3729:Dnah12 UTSW 14 26,427,220 (GRCm39) missense probably benign 0.02
R3799:Dnah12 UTSW 14 26,492,880 (GRCm39) missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26,431,366 (GRCm39) missense probably benign 0.00
R3892:Dnah12 UTSW 14 26,578,573 (GRCm39) missense probably benign 0.03
R3921:Dnah12 UTSW 14 26,493,008 (GRCm39) missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26,444,754 (GRCm39) missense probably benign
R4065:Dnah12 UTSW 14 26,492,405 (GRCm39) missense probably benign 0.02
R4113:Dnah12 UTSW 14 26,414,722 (GRCm39) missense probably damaging 0.98
R4249:Dnah12 UTSW 14 26,430,341 (GRCm39) missense possibly damaging 0.70
R4259:Dnah12 UTSW 14 26,520,883 (GRCm39) missense probably benign 0.01
R4260:Dnah12 UTSW 14 26,520,883 (GRCm39) missense probably benign 0.01
R4348:Dnah12 UTSW 14 26,536,498 (GRCm39) missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26,537,464 (GRCm39) missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26,455,758 (GRCm39) missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26,455,758 (GRCm39) missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26,593,812 (GRCm39) missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26,598,915 (GRCm39) missense possibly damaging 0.83
R4523:Dnah12 UTSW 14 26,491,979 (GRCm39) missense probably damaging 0.97
R4546:Dnah12 UTSW 14 26,494,971 (GRCm39) missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26,494,551 (GRCm39) missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26,456,913 (GRCm39) missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26,427,994 (GRCm39) missense probably benign 0.00
R4727:Dnah12 UTSW 14 26,594,274 (GRCm39) missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26,503,741 (GRCm39) missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26,503,741 (GRCm39) missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26,437,784 (GRCm39) nonsense probably null
R4879:Dnah12 UTSW 14 26,439,201 (GRCm39) critical splice donor site probably null
R4893:Dnah12 UTSW 14 26,431,325 (GRCm39) missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26,455,725 (GRCm39) missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26,583,762 (GRCm39) nonsense probably null
R4939:Dnah12 UTSW 14 26,613,481 (GRCm39) missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26,437,855 (GRCm39) missense probably benign 0.00
R5011:Dnah12 UTSW 14 26,431,326 (GRCm39) missense probably benign 0.03
R5013:Dnah12 UTSW 14 26,431,326 (GRCm39) missense probably benign 0.03
R5043:Dnah12 UTSW 14 26,606,147 (GRCm39) missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26,456,852 (GRCm39) missense probably benign 0.09
R5122:Dnah12 UTSW 14 26,439,155 (GRCm39) missense probably benign 0.00
R5135:Dnah12 UTSW 14 26,492,434 (GRCm39) missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26,572,883 (GRCm39) nonsense probably null
R5154:Dnah12 UTSW 14 26,571,320 (GRCm39) missense probably benign 0.12
R5206:Dnah12 UTSW 14 26,491,942 (GRCm39) missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26,414,641 (GRCm39) missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26,495,787 (GRCm39) missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26,601,695 (GRCm39) missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26,536,494 (GRCm39) missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26,496,299 (GRCm39) splice site probably null
R5389:Dnah12 UTSW 14 26,456,904 (GRCm39) missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26,581,256 (GRCm39) missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26,493,007 (GRCm39) missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26,431,424 (GRCm39) missense probably benign 0.01
R5681:Dnah12 UTSW 14 26,537,452 (GRCm39) missense probably benign 0.32
R5824:Dnah12 UTSW 14 26,492,475 (GRCm39) critical splice donor site probably null
R5863:Dnah12 UTSW 14 26,576,878 (GRCm39) missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26,428,039 (GRCm39) missense probably benign 0.09
R5912:Dnah12 UTSW 14 26,491,965 (GRCm39) nonsense probably null
R5916:Dnah12 UTSW 14 26,428,073 (GRCm39) missense possibly damaging 0.92
R5941:Dnah12 UTSW 14 26,428,022 (GRCm39) missense probably benign 0.00
R5987:Dnah12 UTSW 14 26,608,828 (GRCm39) missense possibly damaging 0.54
R5992:Dnah12 UTSW 14 26,418,496 (GRCm39) missense probably benign 0.04
R6132:Dnah12 UTSW 14 26,439,066 (GRCm39) missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26,597,227 (GRCm39) missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26,495,642 (GRCm39) missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26,583,726 (GRCm39) missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26,431,412 (GRCm39) missense probably benign 0.03
R6235:Dnah12 UTSW 14 26,576,761 (GRCm39) missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26,492,439 (GRCm39) missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26,439,129 (GRCm39) missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26,427,989 (GRCm39) missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26,600,008 (GRCm39) missense probably benign 0.06
R6480:Dnah12 UTSW 14 26,594,412 (GRCm39) missense probably damaging 1.00
R6530:Dnah12 UTSW 14 26,456,865 (GRCm39) missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26,456,847 (GRCm39) missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26,594,706 (GRCm39) missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26,518,180 (GRCm39) missense probably benign 0.02
R6745:Dnah12 UTSW 14 26,428,383 (GRCm39) missense probably damaging 0.99
R6788:Dnah12 UTSW 14 26,523,470 (GRCm39) missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26,456,904 (GRCm39) missense probably damaging 1.00
R6912:Dnah12 UTSW 14 26,600,036 (GRCm39) missense probably damaging 1.00
R6982:Dnah12 UTSW 14 26,521,033 (GRCm39) splice site probably null
R7001:Dnah12 UTSW 14 26,601,681 (GRCm39) missense probably damaging 0.99
R7002:Dnah12 UTSW 14 26,598,955 (GRCm39) missense probably damaging 1.00
R7017:Dnah12 UTSW 14 26,456,835 (GRCm39) missense probably benign
R7107:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7108:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7121:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7122:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7135:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7135:Dnah12 UTSW 14 26,523,370 (GRCm39) missense probably damaging 0.99
R7150:Dnah12 UTSW 14 26,583,689 (GRCm39) missense probably damaging 0.99
R7188:Dnah12 UTSW 14 26,536,370 (GRCm39) missense probably benign 0.04
R7201:Dnah12 UTSW 14 26,536,579 (GRCm39) missense probably benign 0.08
R7202:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7204:Dnah12 UTSW 14 26,503,442 (GRCm39) missense probably damaging 0.99
R7204:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7205:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7206:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7219:Dnah12 UTSW 14 26,576,837 (GRCm39) missense probably damaging 0.99
R7337:Dnah12 UTSW 14 26,488,534 (GRCm39) splice site probably null
R7339:Dnah12 UTSW 14 26,594,277 (GRCm39) missense probably benign
R7363:Dnah12 UTSW 14 26,445,766 (GRCm39) missense probably benign
R7426:Dnah12 UTSW 14 26,445,781 (GRCm39) missense probably benign 0.01
R7472:Dnah12 UTSW 14 26,578,592 (GRCm39) missense probably benign 0.01
R7579:Dnah12 UTSW 14 26,492,460 (GRCm39) missense probably benign 0.05
R7655:Dnah12 UTSW 14 26,581,273 (GRCm39) missense probably benign 0.21
R7656:Dnah12 UTSW 14 26,581,273 (GRCm39) missense probably benign 0.21
R7694:Dnah12 UTSW 14 26,503,337 (GRCm39) missense probably damaging 1.00
R7730:Dnah12 UTSW 14 26,507,890 (GRCm39) missense probably damaging 1.00
R7837:Dnah12 UTSW 14 26,518,176 (GRCm39) missense probably benign 0.01
R7855:Dnah12 UTSW 14 26,551,286 (GRCm39) missense probably benign 0.14
R7870:Dnah12 UTSW 14 26,578,486 (GRCm39) missense probably benign 0.00
R7920:Dnah12 UTSW 14 26,578,499 (GRCm39) missense possibly damaging 0.58
R7933:Dnah12 UTSW 14 26,488,072 (GRCm39) missense probably benign 0.00
R7956:Dnah12 UTSW 14 26,430,427 (GRCm39) missense probably damaging 0.96
R8192:Dnah12 UTSW 14 26,428,036 (GRCm39) missense probably benign
R8263:Dnah12 UTSW 14 26,613,421 (GRCm39) missense noncoding transcript
R8287:Dnah12 UTSW 14 26,534,560 (GRCm39) missense probably benign
R8336:Dnah12 UTSW 14 26,432,220 (GRCm39) missense probably benign 0.01
R8362:Dnah12 UTSW 14 26,576,788 (GRCm39) missense probably damaging 1.00
R8392:Dnah12 UTSW 14 26,607,869 (GRCm39) missense probably benign
R8458:Dnah12 UTSW 14 26,548,849 (GRCm39) critical splice acceptor site probably null
R8481:Dnah12 UTSW 14 26,575,753 (GRCm39) missense probably benign 0.02
R8551:Dnah12 UTSW 14 26,496,227 (GRCm39) missense probably damaging 0.97
R8669:Dnah12 UTSW 14 26,552,582 (GRCm39) splice site probably benign
R8698:Dnah12 UTSW 14 26,428,418 (GRCm39) missense probably benign 0.02
R8709:Dnah12 UTSW 14 26,414,757 (GRCm39) missense probably benign 0.00
R8778:Dnah12 UTSW 14 26,455,718 (GRCm39) missense probably benign 0.29
R9049:Dnah12 UTSW 14 26,443,275 (GRCm39) missense probably benign 0.00
R9087:Dnah12 UTSW 14 26,546,503 (GRCm39) missense probably damaging 1.00
R9099:Dnah12 UTSW 14 26,492,325 (GRCm39) missense probably benign 0.31
R9153:Dnah12 UTSW 14 26,536,569 (GRCm39) missense probably damaging 1.00
R9177:Dnah12 UTSW 14 26,571,255 (GRCm39) missense possibly damaging 0.84
R9214:Dnah12 UTSW 14 26,445,060 (GRCm39) missense probably benign 0.02
R9268:Dnah12 UTSW 14 26,571,255 (GRCm39) missense possibly damaging 0.84
R9274:Dnah12 UTSW 14 26,537,374 (GRCm39) missense probably benign 0.00
R9293:Dnah12 UTSW 14 26,495,016 (GRCm39) missense probably benign
R9322:Dnah12 UTSW 14 26,492,934 (GRCm39) missense possibly damaging 0.75
R9353:Dnah12 UTSW 14 26,578,507 (GRCm39) missense probably damaging 1.00
R9506:Dnah12 UTSW 14 26,514,168 (GRCm39) missense probably benign 0.00
R9518:Dnah12 UTSW 14 26,495,713 (GRCm39) missense probably damaging 1.00
R9524:Dnah12 UTSW 14 26,572,494 (GRCm39) missense probably null 0.91
R9562:Dnah12 UTSW 14 26,597,281 (GRCm39) missense possibly damaging 0.58
R9573:Dnah12 UTSW 14 26,414,619 (GRCm39) missense probably benign
R9581:Dnah12 UTSW 14 26,491,985 (GRCm39) missense probably damaging 1.00
R9689:Dnah12 UTSW 14 26,590,871 (GRCm39) missense probably null 1.00
R9727:Dnah12 UTSW 14 26,523,510 (GRCm39) nonsense probably null
V7580:Dnah12 UTSW 14 26,495,050 (GRCm39) missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26,495,050 (GRCm39) missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26,536,437 (GRCm39) missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26,538,245 (GRCm39) missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26,536,602 (GRCm39) missense possibly damaging 0.93
Z1177:Dnah12 UTSW 14 26,597,172 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTGAAAATAGACCCTGGTAATG -3'
(R):5'- GCAGGACTTATTTCAGGGAAGG -3'

Sequencing Primer
(F):5'- AAATAGACCCTGGTAATGAAAAGATC -3'
(R):5'- TTAGGCAAGTGCTCCACTACTGAG -3'
Posted On 2022-08-09