Incidental Mutation 'R9565:Espl1'
ID 721532
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms ESP1, SSE, separase, PRCE, Cerp, PRCE
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9565 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 102204701-102232792 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 102228233 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1669 (I1669N)
Ref Sequence ENSEMBL: ENSMUSP00000064465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
AlphaFold P60330
Predicted Effect possibly damaging
Transcript: ENSMUST00000064924
AA Change: I1669N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: I1669N

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000229050
AA Change: I1669N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000229942
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 G A 15: 81,773,635 (GRCm39) R58Q probably null Het
Actl11 A T 9: 107,808,121 (GRCm39) T815S possibly damaging Het
Actr5 A G 2: 158,470,135 (GRCm39) D255G probably damaging Het
Acvr1 T C 2: 58,338,385 (GRCm39) K446E probably damaging Het
Adam39 T C 8: 41,277,755 (GRCm39) Y49H probably benign Het
Adcy7 TGG TG 8: 89,053,053 (GRCm39) probably null Het
Amn1 C T 6: 149,090,103 (GRCm39) probably benign Het
Ankdd1a C T 9: 65,411,452 (GRCm39) A352T possibly damaging Het
Aoc1l2 T C 6: 48,907,909 (GRCm39) M303T probably benign Het
Arl4c A G 1: 88,629,134 (GRCm39) C85R probably damaging Het
Asgr2 T A 11: 69,996,310 (GRCm39) probably null Het
Bdkrb1 G A 12: 105,571,078 (GRCm39) V215I probably benign Het
Btn2a2 C A 13: 23,662,848 (GRCm39) K367N possibly damaging Het
Btnl10 T A 11: 58,813,189 (GRCm39) F273I probably benign Het
C7 T A 15: 5,086,579 (GRCm39) probably null Het
Cap1 A G 4: 122,758,505 (GRCm39) V225A probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,128,173 (GRCm39) probably benign Het
Ccdc18 A G 5: 108,339,800 (GRCm39) T782A probably damaging Het
Ccdc187 T C 2: 26,183,698 (GRCm39) S101G possibly damaging Het
Ccdc30 T C 4: 119,250,821 (GRCm39) N141S possibly damaging Het
Cdc42bpg T G 19: 6,370,696 (GRCm39) L1263R probably damaging Het
Cdc42ep1 A T 15: 78,733,782 (GRCm39) H294L probably benign Het
Cdk12 A G 11: 98,140,628 (GRCm39) N1290D unknown Het
Ces1g A G 8: 94,061,792 (GRCm39) V38A probably benign Het
Cntnap4 A C 8: 113,582,982 (GRCm39) Y1020S probably benign Het
Col7a1 T C 9: 108,791,809 (GRCm39) V1232A unknown Het
Ctdsp2 A G 10: 126,832,040 (GRCm39) D216G probably damaging Het
Cyp2j6 A G 4: 96,414,245 (GRCm39) I340T probably damaging Het
Cyp4f37 A G 17: 32,844,205 (GRCm39) D103G possibly damaging Het
Dlgap1 T G 17: 70,964,458 (GRCm39) N400K probably benign Het
Dnaaf9 G A 2: 130,648,711 (GRCm39) T257M unknown Het
Dnah1 C A 14: 30,986,394 (GRCm39) A3698S probably damaging Het
Dnah12 C A 14: 26,597,281 (GRCm39) R3547S possibly damaging Het
Dnah3 A G 7: 119,610,114 (GRCm39) V1774A probably benign Het
Drc7 A G 8: 95,801,866 (GRCm39) E709G probably damaging Het
Dsc1 T A 18: 20,240,791 (GRCm39) D178V probably damaging Het
Duox1 T C 2: 122,151,203 (GRCm39) Y293H probably damaging Het
Elp1 G T 4: 56,772,521 (GRCm39) P867T probably benign Het
Epas1 T A 17: 87,112,667 (GRCm39) D88E probably damaging Het
Epdr1 A G 13: 19,778,821 (GRCm39) F92L possibly damaging Het
Eri3 T A 4: 117,422,013 (GRCm39) V136E probably benign Het
Etv6 A G 6: 134,225,672 (GRCm39) N212S probably benign Het
Fam186b A T 15: 99,176,685 (GRCm39) L735Q probably damaging Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Fan1 A G 7: 63,999,240 (GRCm39) L874P possibly damaging Het
Fancm A G 12: 65,168,494 (GRCm39) N1619S probably damaging Het
Fbln5 A T 12: 101,734,722 (GRCm39) N183K probably damaging Het
Fbn2 T C 18: 58,228,298 (GRCm39) H746R probably benign Het
Fbxw17 T C 13: 50,579,605 (GRCm39) W141R probably damaging Het
Fbxw25 T A 9: 109,483,676 (GRCm39) N179Y Het
Gbe1 A T 16: 70,198,664 (GRCm39) Y119F probably benign Het
Gcnt7 T A 2: 172,293,180 (GRCm39) Y369F probably damaging Het
Gdf9 T A 11: 53,327,511 (GRCm39) S156T probably damaging Het
Gm14295 T C 2: 176,499,162 (GRCm39) V4A probably benign Het
Gm8369 A C 19: 11,489,015 (GRCm39) T101P probably benign Het
Herc3 A G 6: 58,835,999 (GRCm39) N280S probably null Het
Hipk2 T A 6: 38,724,390 (GRCm39) R447W probably damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,194,000 (GRCm39) probably benign Het
Hltf G A 3: 20,136,996 (GRCm39) probably null Het
Ik C A 18: 36,886,959 (GRCm39) D397E probably benign Het
Inka1 T A 9: 107,861,488 (GRCm39) Y276F probably benign Het
Kcnc1 G A 7: 46,077,010 (GRCm39) V271M probably benign Het
Kif21b A T 1: 136,077,090 (GRCm39) I371F probably damaging Het
Klrc1 A G 6: 129,655,746 (GRCm39) F43S probably damaging Het
Krt8 A G 15: 101,912,460 (GRCm39) V72A probably benign Het
Krtap6-2 A G 16: 89,216,722 (GRCm39) S82P unknown Het
Lrrc15 G A 16: 30,093,016 (GRCm39) L108F probably damaging Het
Lvrn T G 18: 47,017,506 (GRCm39) I612S probably damaging Het
Map3k3 T A 11: 106,041,860 (GRCm39) I413N probably damaging Het
Mark3 A G 12: 111,570,960 (GRCm39) I87V probably damaging Het
Mki67 GTT GTTT 7: 135,309,233 (GRCm39) probably null Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mrgprb2 G A 7: 48,202,674 (GRCm39) T17M possibly damaging Het
Msantd5f4 G T 4: 73,557,190 (GRCm39) V8F probably damaging Het
Myh3 C T 11: 66,983,187 (GRCm39) R905* probably null Het
Myh8 T C 11: 67,177,215 (GRCm39) V427A probably benign Het
Myocd T C 11: 65,078,209 (GRCm39) K529E probably damaging Het
Myom2 A T 8: 15,158,399 (GRCm39) K784* probably null Het
Or1l4 G T 2: 37,091,575 (GRCm39) M107I probably benign Het
Or2w25 T G 11: 59,504,339 (GRCm39) I183S probably damaging Het
Or6c33 T C 10: 129,853,287 (GRCm39) I19T probably benign Het
Pabpc4 T C 4: 123,180,653 (GRCm39) I125T probably damaging Het
Parp14 A G 16: 35,677,775 (GRCm39) I731T probably benign Het
Pde6c T A 19: 38,147,008 (GRCm39) probably null Het
Pias3 T A 3: 96,610,867 (GRCm39) C391S possibly damaging Het
Pknox2 A T 9: 36,835,067 (GRCm39) M134K probably damaging Het
Pot1b A G 17: 55,969,465 (GRCm39) S568P possibly damaging Het
Ppp1r3a T A 6: 14,719,466 (GRCm39) T483S probably benign Het
Rag1 A T 2: 101,473,327 (GRCm39) V605E probably damaging Het
Relch T C 1: 105,591,876 (GRCm39) V15A probably damaging Het
Ros1 T C 10: 51,943,170 (GRCm39) D2048G probably damaging Het
Rp2 A G X: 20,243,781 (GRCm39) D252G probably benign Het
Rpgrip1l A C 8: 92,031,516 (GRCm39) H120Q probably benign Het
Rpl24 T A 16: 55,790,509 (GRCm39) S122T probably benign Het
Sec61b A G 4: 47,483,049 (GRCm39) Y93C probably damaging Het
Sema6a A T 18: 47,382,594 (GRCm39) L651Q probably null Het
Serpinb6a T A 13: 34,102,400 (GRCm39) K275I probably damaging Het
Skic2 C T 17: 35,063,758 (GRCm39) A562T probably benign Het
Skor2 C T 18: 76,946,376 (GRCm39) H33Y unknown Het
Slc26a7 T C 4: 14,519,496 (GRCm39) N508S probably benign Het
Slc2a4 A G 11: 69,837,173 (GRCm39) F88L probably damaging Het
Slc8b1 A G 5: 120,665,865 (GRCm39) T399A probably benign Het
Slfn5 A T 11: 82,847,699 (GRCm39) M195L possibly damaging Het
Snx17 C A 5: 31,355,088 (GRCm39) Q368K probably damaging Het
Tasor T C 14: 27,201,766 (GRCm39) probably null Het
Tbcb A T 7: 29,930,549 (GRCm39) probably null Het
Telo2 A G 17: 25,334,199 (GRCm39) I16T probably benign Het
Timm50 A G 7: 28,007,069 (GRCm39) F202S possibly damaging Het
Tle2 A G 10: 81,417,567 (GRCm39) D244G probably benign Het
Tlr4 G A 4: 66,759,522 (GRCm39) V772I possibly damaging Het
Tmem214 G A 5: 31,027,043 (GRCm39) W11* probably null Het
Top2b A C 14: 16,365,718 (GRCm38) T14P probably benign Het
Trim44 T C 2: 102,187,827 (GRCm39) T309A probably benign Het
Tuba8 A G 6: 121,200,063 (GRCm39) N249S probably benign Het
Tubb4a A G 17: 57,388,027 (GRCm39) V333A probably benign Het
Ugdh C A 5: 65,575,876 (GRCm39) D328Y possibly damaging Het
Vmn1r189 A G 13: 22,286,426 (GRCm39) L137P probably damaging Het
Vmn1r208 A G 13: 22,956,789 (GRCm39) V236A probably damaging Het
Vmn2r29 A T 7: 7,244,855 (GRCm39) W340R probably benign Het
Vmn2r52 A C 7: 9,893,476 (GRCm39) D554E probably benign Het
Wdr36 C T 18: 32,994,168 (GRCm39) Q669* probably null Het
Wiz G T 17: 32,575,939 (GRCm39) D812E probably benign Het
Zfp777 A T 6: 48,021,580 (GRCm39) V14D possibly damaging Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102,208,248 (GRCm39) missense probably damaging 1.00
IGL00839:Espl1 APN 15 102,228,982 (GRCm39) unclassified probably benign
IGL00919:Espl1 APN 15 102,207,064 (GRCm39) missense probably benign 0.03
IGL01125:Espl1 APN 15 102,231,373 (GRCm39) missense probably damaging 1.00
IGL01366:Espl1 APN 15 102,228,271 (GRCm39) missense probably benign 0.00
IGL01488:Espl1 APN 15 102,207,174 (GRCm39) missense probably benign
IGL01554:Espl1 APN 15 102,221,660 (GRCm39) missense probably damaging 1.00
IGL01810:Espl1 APN 15 102,206,640 (GRCm39) missense probably benign
IGL01959:Espl1 APN 15 102,214,097 (GRCm39) splice site probably benign
IGL02267:Espl1 APN 15 102,224,099 (GRCm39) missense probably benign 0.01
IGL02452:Espl1 APN 15 102,208,274 (GRCm39) missense probably damaging 1.00
IGL02469:Espl1 APN 15 102,222,460 (GRCm39) missense probably damaging 1.00
IGL02500:Espl1 APN 15 102,224,235 (GRCm39) missense probably benign
IGL02630:Espl1 APN 15 102,205,253 (GRCm39) missense probably benign 0.11
IGL02687:Espl1 APN 15 102,221,613 (GRCm39) splice site probably benign
IGL02868:Espl1 APN 15 102,222,425 (GRCm39) nonsense probably null
IGL02926:Espl1 APN 15 102,208,290 (GRCm39) missense probably damaging 0.99
R0019:Espl1 UTSW 15 102,214,754 (GRCm39) missense probably null 0.01
R0129:Espl1 UTSW 15 102,225,083 (GRCm39) missense probably benign 0.00
R0184:Espl1 UTSW 15 102,207,651 (GRCm39) missense probably benign 0.01
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0267:Espl1 UTSW 15 102,221,452 (GRCm39) missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102,212,421 (GRCm39) nonsense probably null
R0587:Espl1 UTSW 15 102,212,382 (GRCm39) splice site probably benign
R0726:Espl1 UTSW 15 102,231,033 (GRCm39) missense probably benign
R1186:Espl1 UTSW 15 102,212,474 (GRCm39) missense probably benign 0.05
R1282:Espl1 UTSW 15 102,223,826 (GRCm39) missense probably benign 0.00
R1428:Espl1 UTSW 15 102,214,120 (GRCm39) missense probably benign 0.06
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1473:Espl1 UTSW 15 102,228,878 (GRCm39) missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102,206,802 (GRCm39) missense probably damaging 0.98
R1639:Espl1 UTSW 15 102,229,149 (GRCm39) missense probably damaging 1.00
R1725:Espl1 UTSW 15 102,221,656 (GRCm39) missense probably benign 0.08
R1748:Espl1 UTSW 15 102,206,964 (GRCm39) missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102,207,448 (GRCm39) missense probably benign
R1938:Espl1 UTSW 15 102,213,477 (GRCm39) missense probably benign 0.00
R1954:Espl1 UTSW 15 102,206,823 (GRCm39) missense probably damaging 1.00
R2009:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2014:Espl1 UTSW 15 102,231,149 (GRCm39) nonsense probably null
R2067:Espl1 UTSW 15 102,207,525 (GRCm39) missense probably damaging 0.96
R2084:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R2164:Espl1 UTSW 15 102,228,023 (GRCm39) missense probably damaging 1.00
R2204:Espl1 UTSW 15 102,214,340 (GRCm39) missense probably damaging 1.00
R2220:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2237:Espl1 UTSW 15 102,224,004 (GRCm39) missense probably damaging 0.98
R2314:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3107:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3108:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3114:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3616:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3733:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3958:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3959:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3960:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4062:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4063:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4064:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4165:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4166:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4349:Espl1 UTSW 15 102,228,039 (GRCm39) missense probably benign 0.26
R4373:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4376:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4377:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4516:Espl1 UTSW 15 102,231,671 (GRCm39) missense probably benign 0.00
R4595:Espl1 UTSW 15 102,207,159 (GRCm39) missense probably benign 0.01
R4884:Espl1 UTSW 15 102,232,505 (GRCm39) missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102,230,758 (GRCm39) critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102,223,676 (GRCm39) missense probably damaging 0.98
R4931:Espl1 UTSW 15 102,214,165 (GRCm39) missense probably benign 0.02
R4936:Espl1 UTSW 15 102,213,372 (GRCm39) missense probably damaging 1.00
R5000:Espl1 UTSW 15 102,206,986 (GRCm39) missense probably damaging 1.00
R5220:Espl1 UTSW 15 102,207,012 (GRCm39) missense probably benign 0.03
R5329:Espl1 UTSW 15 102,220,953 (GRCm39) missense probably damaging 0.97
R5501:Espl1 UTSW 15 102,225,565 (GRCm39) missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102,232,465 (GRCm39) missense probably damaging 1.00
R5848:Espl1 UTSW 15 102,231,011 (GRCm39) missense probably benign 0.03
R5906:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R5978:Espl1 UTSW 15 102,224,209 (GRCm39) missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102,208,323 (GRCm39) missense probably damaging 0.99
R6313:Espl1 UTSW 15 102,224,247 (GRCm39) missense probably benign 0.00
R6414:Espl1 UTSW 15 102,223,995 (GRCm39) missense probably damaging 0.96
R6484:Espl1 UTSW 15 102,231,935 (GRCm39) missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102,207,660 (GRCm39) missense probably benign
R6928:Espl1 UTSW 15 102,207,342 (GRCm39) missense probably benign 0.28
R6995:Espl1 UTSW 15 102,212,535 (GRCm39) missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102,225,328 (GRCm39) critical splice donor site probably null
R7062:Espl1 UTSW 15 102,207,331 (GRCm39) missense probably benign 0.00
R7135:Espl1 UTSW 15 102,227,959 (GRCm39) nonsense probably null
R7154:Espl1 UTSW 15 102,232,484 (GRCm39) missense probably damaging 1.00
R7164:Espl1 UTSW 15 102,221,638 (GRCm39) missense probably damaging 1.00
R7522:Espl1 UTSW 15 102,213,486 (GRCm39) missense probably damaging 1.00
R7848:Espl1 UTSW 15 102,224,961 (GRCm39) missense probably damaging 1.00
R7894:Espl1 UTSW 15 102,212,460 (GRCm39) missense probably damaging 1.00
R8275:Espl1 UTSW 15 102,211,188 (GRCm39) splice site probably benign
R8752:Espl1 UTSW 15 102,214,759 (GRCm39) missense probably damaging 1.00
R9160:Espl1 UTSW 15 102,206,953 (GRCm39) missense probably damaging 1.00
R9310:Espl1 UTSW 15 102,205,285 (GRCm39) critical splice donor site probably null
R9385:Espl1 UTSW 15 102,207,185 (GRCm39) missense probably damaging 0.99
R9532:Espl1 UTSW 15 102,228,260 (GRCm39) nonsense probably null
R9563:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9723:Espl1 UTSW 15 102,229,170 (GRCm39) missense probably benign 0.43
X0062:Espl1 UTSW 15 102,206,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGATCCTTATGCCACTGCG -3'
(R):5'- TGGGCTACACACAAAGATCCAG -3'

Sequencing Primer
(F):5'- TTGCACCGACAGCTCAG -3'
(R):5'- GGCCAGGTAAACTAAGCAATATC -3'
Posted On 2022-08-09