Incidental Mutation 'R9565:Pot1b'
ID 721542
Institutional Source Beutler Lab
Gene Symbol Pot1b
Ensembl Gene ENSMUSG00000024174
Gene Name protection of telomeres 1B
Synonyms 2810458H16Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9565 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 55958951-56019628 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 55969465 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 568 (S568P)
Ref Sequence ENSEMBL: ENSMUSP00000084089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086876]
AlphaFold H7BX60
Predicted Effect possibly damaging
Transcript: ENSMUST00000086876
AA Change: S568P

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084089
Gene: ENSMUSG00000024174
AA Change: S568P

DomainStartEndE-ValueType
Telo_bind 11 141 1.74e-51 SMART
Pfam:POT1PC 152 299 7.9e-40 PFAM
low complexity region 313 333 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for one null mutation display male infertility with age, male germ cell apoptosis, hyperpigmentation, increased apoptosis in intestinal crypts, and decreased body size. Mice homozygous for a transgenic gene disruption exhibit neonatal lethality with possible stem cell defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 G A 15: 81,773,635 (GRCm39) R58Q probably null Het
Actl11 A T 9: 107,808,121 (GRCm39) T815S possibly damaging Het
Actr5 A G 2: 158,470,135 (GRCm39) D255G probably damaging Het
Acvr1 T C 2: 58,338,385 (GRCm39) K446E probably damaging Het
Adam39 T C 8: 41,277,755 (GRCm39) Y49H probably benign Het
Adcy7 TGG TG 8: 89,053,053 (GRCm39) probably null Het
Amn1 C T 6: 149,090,103 (GRCm39) probably benign Het
Ankdd1a C T 9: 65,411,452 (GRCm39) A352T possibly damaging Het
Aoc1l2 T C 6: 48,907,909 (GRCm39) M303T probably benign Het
Arl4c A G 1: 88,629,134 (GRCm39) C85R probably damaging Het
Asgr2 T A 11: 69,996,310 (GRCm39) probably null Het
Bdkrb1 G A 12: 105,571,078 (GRCm39) V215I probably benign Het
Btn2a2 C A 13: 23,662,848 (GRCm39) K367N possibly damaging Het
Btnl10 T A 11: 58,813,189 (GRCm39) F273I probably benign Het
C7 T A 15: 5,086,579 (GRCm39) probably null Het
Cap1 A G 4: 122,758,505 (GRCm39) V225A probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,128,173 (GRCm39) probably benign Het
Ccdc18 A G 5: 108,339,800 (GRCm39) T782A probably damaging Het
Ccdc187 T C 2: 26,183,698 (GRCm39) S101G possibly damaging Het
Ccdc30 T C 4: 119,250,821 (GRCm39) N141S possibly damaging Het
Cdc42bpg T G 19: 6,370,696 (GRCm39) L1263R probably damaging Het
Cdc42ep1 A T 15: 78,733,782 (GRCm39) H294L probably benign Het
Cdk12 A G 11: 98,140,628 (GRCm39) N1290D unknown Het
Ces1g A G 8: 94,061,792 (GRCm39) V38A probably benign Het
Cntnap4 A C 8: 113,582,982 (GRCm39) Y1020S probably benign Het
Col7a1 T C 9: 108,791,809 (GRCm39) V1232A unknown Het
Ctdsp2 A G 10: 126,832,040 (GRCm39) D216G probably damaging Het
Cyp2j6 A G 4: 96,414,245 (GRCm39) I340T probably damaging Het
Cyp4f37 A G 17: 32,844,205 (GRCm39) D103G possibly damaging Het
Dlgap1 T G 17: 70,964,458 (GRCm39) N400K probably benign Het
Dnaaf9 G A 2: 130,648,711 (GRCm39) T257M unknown Het
Dnah1 C A 14: 30,986,394 (GRCm39) A3698S probably damaging Het
Dnah12 C A 14: 26,597,281 (GRCm39) R3547S possibly damaging Het
Dnah3 A G 7: 119,610,114 (GRCm39) V1774A probably benign Het
Drc7 A G 8: 95,801,866 (GRCm39) E709G probably damaging Het
Dsc1 T A 18: 20,240,791 (GRCm39) D178V probably damaging Het
Duox1 T C 2: 122,151,203 (GRCm39) Y293H probably damaging Het
Elp1 G T 4: 56,772,521 (GRCm39) P867T probably benign Het
Epas1 T A 17: 87,112,667 (GRCm39) D88E probably damaging Het
Epdr1 A G 13: 19,778,821 (GRCm39) F92L possibly damaging Het
Eri3 T A 4: 117,422,013 (GRCm39) V136E probably benign Het
Espl1 T A 15: 102,228,233 (GRCm39) I1669N possibly damaging Het
Etv6 A G 6: 134,225,672 (GRCm39) N212S probably benign Het
Fam186b A T 15: 99,176,685 (GRCm39) L735Q probably damaging Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Fan1 A G 7: 63,999,240 (GRCm39) L874P possibly damaging Het
Fancm A G 12: 65,168,494 (GRCm39) N1619S probably damaging Het
Fbln5 A T 12: 101,734,722 (GRCm39) N183K probably damaging Het
Fbn2 T C 18: 58,228,298 (GRCm39) H746R probably benign Het
Fbxw17 T C 13: 50,579,605 (GRCm39) W141R probably damaging Het
Fbxw25 T A 9: 109,483,676 (GRCm39) N179Y Het
Gbe1 A T 16: 70,198,664 (GRCm39) Y119F probably benign Het
Gcnt7 T A 2: 172,293,180 (GRCm39) Y369F probably damaging Het
Gdf9 T A 11: 53,327,511 (GRCm39) S156T probably damaging Het
Gm14295 T C 2: 176,499,162 (GRCm39) V4A probably benign Het
Gm8369 A C 19: 11,489,015 (GRCm39) T101P probably benign Het
Herc3 A G 6: 58,835,999 (GRCm39) N280S probably null Het
Hipk2 T A 6: 38,724,390 (GRCm39) R447W probably damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,194,000 (GRCm39) probably benign Het
Hltf G A 3: 20,136,996 (GRCm39) probably null Het
Ik C A 18: 36,886,959 (GRCm39) D397E probably benign Het
Inka1 T A 9: 107,861,488 (GRCm39) Y276F probably benign Het
Kcnc1 G A 7: 46,077,010 (GRCm39) V271M probably benign Het
Kif21b A T 1: 136,077,090 (GRCm39) I371F probably damaging Het
Klrc1 A G 6: 129,655,746 (GRCm39) F43S probably damaging Het
Krt8 A G 15: 101,912,460 (GRCm39) V72A probably benign Het
Krtap6-2 A G 16: 89,216,722 (GRCm39) S82P unknown Het
Lrrc15 G A 16: 30,093,016 (GRCm39) L108F probably damaging Het
Lvrn T G 18: 47,017,506 (GRCm39) I612S probably damaging Het
Map3k3 T A 11: 106,041,860 (GRCm39) I413N probably damaging Het
Mark3 A G 12: 111,570,960 (GRCm39) I87V probably damaging Het
Mki67 GTT GTTT 7: 135,309,233 (GRCm39) probably null Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mrgprb2 G A 7: 48,202,674 (GRCm39) T17M possibly damaging Het
Msantd5f4 G T 4: 73,557,190 (GRCm39) V8F probably damaging Het
Myh3 C T 11: 66,983,187 (GRCm39) R905* probably null Het
Myh8 T C 11: 67,177,215 (GRCm39) V427A probably benign Het
Myocd T C 11: 65,078,209 (GRCm39) K529E probably damaging Het
Myom2 A T 8: 15,158,399 (GRCm39) K784* probably null Het
Or1l4 G T 2: 37,091,575 (GRCm39) M107I probably benign Het
Or2w25 T G 11: 59,504,339 (GRCm39) I183S probably damaging Het
Or6c33 T C 10: 129,853,287 (GRCm39) I19T probably benign Het
Pabpc4 T C 4: 123,180,653 (GRCm39) I125T probably damaging Het
Parp14 A G 16: 35,677,775 (GRCm39) I731T probably benign Het
Pde6c T A 19: 38,147,008 (GRCm39) probably null Het
Pias3 T A 3: 96,610,867 (GRCm39) C391S possibly damaging Het
Pknox2 A T 9: 36,835,067 (GRCm39) M134K probably damaging Het
Ppp1r3a T A 6: 14,719,466 (GRCm39) T483S probably benign Het
Rag1 A T 2: 101,473,327 (GRCm39) V605E probably damaging Het
Relch T C 1: 105,591,876 (GRCm39) V15A probably damaging Het
Ros1 T C 10: 51,943,170 (GRCm39) D2048G probably damaging Het
Rp2 A G X: 20,243,781 (GRCm39) D252G probably benign Het
Rpgrip1l A C 8: 92,031,516 (GRCm39) H120Q probably benign Het
Rpl24 T A 16: 55,790,509 (GRCm39) S122T probably benign Het
Sec61b A G 4: 47,483,049 (GRCm39) Y93C probably damaging Het
Sema6a A T 18: 47,382,594 (GRCm39) L651Q probably null Het
Serpinb6a T A 13: 34,102,400 (GRCm39) K275I probably damaging Het
Skic2 C T 17: 35,063,758 (GRCm39) A562T probably benign Het
Skor2 C T 18: 76,946,376 (GRCm39) H33Y unknown Het
Slc26a7 T C 4: 14,519,496 (GRCm39) N508S probably benign Het
Slc2a4 A G 11: 69,837,173 (GRCm39) F88L probably damaging Het
Slc8b1 A G 5: 120,665,865 (GRCm39) T399A probably benign Het
Slfn5 A T 11: 82,847,699 (GRCm39) M195L possibly damaging Het
Snx17 C A 5: 31,355,088 (GRCm39) Q368K probably damaging Het
Tasor T C 14: 27,201,766 (GRCm39) probably null Het
Tbcb A T 7: 29,930,549 (GRCm39) probably null Het
Telo2 A G 17: 25,334,199 (GRCm39) I16T probably benign Het
Timm50 A G 7: 28,007,069 (GRCm39) F202S possibly damaging Het
Tle2 A G 10: 81,417,567 (GRCm39) D244G probably benign Het
Tlr4 G A 4: 66,759,522 (GRCm39) V772I possibly damaging Het
Tmem214 G A 5: 31,027,043 (GRCm39) W11* probably null Het
Top2b A C 14: 16,365,718 (GRCm38) T14P probably benign Het
Trim44 T C 2: 102,187,827 (GRCm39) T309A probably benign Het
Tuba8 A G 6: 121,200,063 (GRCm39) N249S probably benign Het
Tubb4a A G 17: 57,388,027 (GRCm39) V333A probably benign Het
Ugdh C A 5: 65,575,876 (GRCm39) D328Y possibly damaging Het
Vmn1r189 A G 13: 22,286,426 (GRCm39) L137P probably damaging Het
Vmn1r208 A G 13: 22,956,789 (GRCm39) V236A probably damaging Het
Vmn2r29 A T 7: 7,244,855 (GRCm39) W340R probably benign Het
Vmn2r52 A C 7: 9,893,476 (GRCm39) D554E probably benign Het
Wdr36 C T 18: 32,994,168 (GRCm39) Q669* probably null Het
Wiz G T 17: 32,575,939 (GRCm39) D812E probably benign Het
Zfp777 A T 6: 48,021,580 (GRCm39) V14D possibly damaging Het
Other mutations in Pot1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Pot1b APN 17 56,002,160 (GRCm39) missense possibly damaging 0.94
IGL01796:Pot1b APN 17 55,976,750 (GRCm39) missense possibly damaging 0.53
IGL01810:Pot1b APN 17 55,969,521 (GRCm39) missense possibly damaging 0.68
IGL02371:Pot1b APN 17 56,002,092 (GRCm39) missense possibly damaging 0.91
IGL02553:Pot1b APN 17 56,002,024 (GRCm39) splice site probably benign
IGL02957:Pot1b APN 17 56,007,009 (GRCm39) missense probably damaging 0.99
IGL02975:Pot1b APN 17 55,969,454 (GRCm39) splice site probably benign
IGL03172:Pot1b APN 17 56,002,206 (GRCm39) missense possibly damaging 0.60
boulder UTSW 17 55,979,865 (GRCm39) nonsense probably null
erosion UTSW 17 55,994,834 (GRCm39) missense probably damaging 0.99
G1Funyon:Pot1b UTSW 17 55,994,895 (GRCm39) missense probably benign
R0020:Pot1b UTSW 17 55,960,429 (GRCm39) missense probably benign 0.03
R0540:Pot1b UTSW 17 55,972,765 (GRCm39) missense probably damaging 0.98
R0607:Pot1b UTSW 17 55,972,765 (GRCm39) missense probably damaging 0.98
R0882:Pot1b UTSW 17 55,973,400 (GRCm39) splice site probably benign
R1164:Pot1b UTSW 17 55,981,085 (GRCm39) missense probably benign 0.18
R1476:Pot1b UTSW 17 55,960,451 (GRCm39) missense possibly damaging 0.73
R1874:Pot1b UTSW 17 55,961,805 (GRCm39) missense probably benign
R1955:Pot1b UTSW 17 55,981,067 (GRCm39) missense possibly damaging 0.73
R1960:Pot1b UTSW 17 55,969,531 (GRCm39) missense probably damaging 0.99
R1961:Pot1b UTSW 17 55,969,531 (GRCm39) missense probably damaging 0.99
R2109:Pot1b UTSW 17 55,960,413 (GRCm39) missense probably benign 0.00
R2895:Pot1b UTSW 17 55,994,939 (GRCm39) missense probably damaging 0.98
R2943:Pot1b UTSW 17 55,981,058 (GRCm39) missense probably benign
R4681:Pot1b UTSW 17 55,961,831 (GRCm39) missense probably benign 0.28
R4763:Pot1b UTSW 17 56,002,160 (GRCm39) missense possibly damaging 0.94
R4821:Pot1b UTSW 17 55,979,885 (GRCm39) missense possibly damaging 0.73
R5079:Pot1b UTSW 17 55,976,801 (GRCm39) missense probably benign 0.18
R5146:Pot1b UTSW 17 55,979,865 (GRCm39) nonsense probably null
R5176:Pot1b UTSW 17 56,006,995 (GRCm39) missense probably benign 0.05
R5394:Pot1b UTSW 17 56,007,063 (GRCm39) missense probably benign 0.19
R5752:Pot1b UTSW 17 55,994,834 (GRCm39) missense probably damaging 0.99
R6866:Pot1b UTSW 17 55,960,474 (GRCm39) missense possibly damaging 0.83
R8301:Pot1b UTSW 17 55,994,895 (GRCm39) missense probably benign
R8390:Pot1b UTSW 17 55,999,739 (GRCm39) missense probably benign 0.00
R8750:Pot1b UTSW 17 55,973,537 (GRCm39) missense probably benign
R9042:Pot1b UTSW 17 56,006,991 (GRCm39) critical splice donor site probably null
R9564:Pot1b UTSW 17 55,969,465 (GRCm39) missense possibly damaging 0.92
R9611:Pot1b UTSW 17 56,006,995 (GRCm39) missense probably benign 0.05
R9727:Pot1b UTSW 17 55,999,795 (GRCm39) missense possibly damaging 0.92
RF014:Pot1b UTSW 17 55,981,106 (GRCm39) missense probably benign 0.12
X0062:Pot1b UTSW 17 56,002,154 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAACGGCTCTTCAGATTTCG -3'
(R):5'- TGATCCTGGAGAAGAAAGCTTTC -3'

Sequencing Primer
(F):5'- GGCTCTTCAGATTTCGTCTCTCAAC -3'
(R):5'- TCCTCACTAGTTCTGGGC -3'
Posted On 2022-08-09