Incidental Mutation 'R9566:Steap4'
ID 721577
Institutional Source Beutler Lab
Gene Symbol Steap4
Ensembl Gene ENSMUSG00000012428
Gene Name STEAP family member 4
Synonyms Tnfaip9, Tiarp
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R9566 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 8010472-8032213 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8025646 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 69 (E69G)
Ref Sequence ENSEMBL: ENSMUSP00000111081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115421]
AlphaFold Q923B6
Predicted Effect possibly damaging
Transcript: ENSMUST00000115421
AA Change: E69G

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111081
Gene: ENSMUSG00000012428
AA Change: E69G

DomainStartEndE-ValueType
Pfam:F420_oxidored 21 107 2.3e-16 PFAM
transmembrane domain 203 225 N/A INTRINSIC
Pfam:Ferric_reduct 247 395 2.6e-14 PFAM
transmembrane domain 416 438 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the STEAP (six transmembrane epithelial antigen of prostate) family, and resides in the golgi apparatus. It functions as a metalloreductase that has the ability to reduce both Fe(3+) to Fe(2+) and Cu(2+) to Cu(1+), using NAD(+) as acceptor. Studies in mice and human suggest that this gene maybe involved in adipocyte development and metabolism, and may contribute to the normal biology of the prostate cell, as well as prostate cancer progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit adipose accumulation, oxidative stress, increased liver weight, lower metabolic rate, hypoactivity, insulin resistance, glucose intolerance, mild hyperglycemia and dyslipidemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik G A 2: 151,314,226 (GRCm39) T484I probably benign Het
4930568D16Rik C A 2: 35,244,645 (GRCm39) E236* probably null Het
Abca13 C A 11: 9,414,927 (GRCm39) T3998K probably damaging Het
Adam8 A G 7: 139,565,285 (GRCm39) V643A probably benign Het
Adamtsl2 T C 2: 26,979,773 (GRCm39) probably null Het
Akr1c18 A T 13: 4,195,203 (GRCm39) probably null Het
Atf7ip2 C T 16: 10,044,893 (GRCm39) S222L probably benign Het
Atp2c1 A T 9: 105,343,828 (GRCm39) I127N probably damaging Het
Bcl11b A G 12: 107,881,784 (GRCm39) Y844H possibly damaging Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Btnl4 A G 17: 34,688,263 (GRCm39) I505T probably benign Het
Cacna1b G A 2: 24,498,092 (GRCm39) Q2024* probably null Het
Cars1 A G 7: 143,113,384 (GRCm39) probably null Het
Ccne2 A G 4: 11,193,026 (GRCm39) K49E probably benign Het
Ccnk A G 12: 108,152,695 (GRCm39) N4S probably benign Het
Cfap91 A G 16: 38,155,996 (GRCm39) F76L probably damaging Het
Clasp1 A G 1: 118,479,801 (GRCm39) D1027G probably benign Het
Copb1 A T 7: 113,825,997 (GRCm39) N662K probably benign Het
Cox8b C T 7: 140,478,926 (GRCm39) S63N probably benign Het
Cpa4 C A 6: 30,579,608 (GRCm39) D138E probably benign Het
Dcc A G 18: 71,943,866 (GRCm39) C262R possibly damaging Het
Dennd5a C T 7: 109,533,254 (GRCm39) G172E probably benign Het
Dgke C T 11: 88,932,273 (GRCm39) probably null Het
Dnah11 A G 12: 117,938,728 (GRCm39) Y3247H possibly damaging Het
Dnajc21 T G 15: 10,464,019 (GRCm39) I49L possibly damaging Het
Dnm1 A G 2: 32,228,011 (GRCm39) probably null Het
Ecd A T 14: 20,393,368 (GRCm39) Y93* probably null Het
Epm2aip1 T C 9: 111,101,807 (GRCm39) L260P probably damaging Het
Eqtn G A 4: 94,813,185 (GRCm39) P134S probably damaging Het
Ercc1 T A 7: 19,088,377 (GRCm39) C243* probably null Het
Fbln2 C A 6: 91,231,513 (GRCm39) H537N probably benign Het
Ffar2 A G 7: 30,518,847 (GRCm39) F231S probably damaging Het
Fhod1 G A 8: 106,064,516 (GRCm39) A172V unknown Het
Gbp8 C T 5: 105,198,799 (GRCm39) V39M probably damaging Het
Gm5773 T C 3: 93,680,742 (GRCm39) L138P probably damaging Het
Gtf2ird2 A G 5: 134,246,256 (GRCm39) E838G probably damaging Het
Gucy2e C A 11: 69,118,947 (GRCm39) V682L probably damaging Het
Hmcn1 T G 1: 150,498,660 (GRCm39) N4073T probably benign Het
Il22b A T 10: 118,130,860 (GRCm39) L12H probably damaging Het
Ist1 A T 8: 110,408,816 (GRCm39) S94T probably benign Het
Klhl24 A T 16: 19,934,669 (GRCm39) N381Y probably damaging Het
Krtap24-1 C T 16: 88,408,886 (GRCm39) C80Y Het
Lcp2 T A 11: 34,000,944 (GRCm39) D42E Het
Map1s G A 8: 71,365,580 (GRCm39) A162T probably benign Het
Mbd5 T G 2: 49,169,521 (GRCm39) V1564G probably damaging Het
Mettl15 A T 2: 108,923,592 (GRCm39) S277T possibly damaging Het
Mfsd12 C G 10: 81,196,962 (GRCm39) T177S probably benign Het
Mlxipl A G 5: 135,152,616 (GRCm39) D244G possibly damaging Het
Mutyh G A 4: 116,673,780 (GRCm39) V164M probably damaging Het
Mypop A G 7: 18,726,534 (GRCm39) D167G probably benign Het
Nbeal2 C T 9: 110,457,989 (GRCm39) V2169M probably benign Het
Nifk G T 1: 118,260,492 (GRCm39) V259F probably damaging Het
Oasl1 A G 5: 115,066,331 (GRCm39) T150A probably benign Het
Obox6 G A 7: 15,568,352 (GRCm39) R175C Het
Or2y11 T C 11: 49,443,162 (GRCm39) V196A probably benign Het
Or5p52 T A 7: 107,502,409 (GRCm39) C162S possibly damaging Het
Or5p69 A T 7: 107,966,783 (GRCm39) I29F probably benign Het
Per3 A G 4: 151,113,335 (GRCm39) F331S Het
Pitrm1 A G 13: 6,613,452 (GRCm39) D508G probably benign Het
Plec T A 15: 76,062,790 (GRCm39) I2427F possibly damaging Het
Prkd3 A T 17: 79,292,652 (GRCm39) V140D probably damaging Het
Prpf3 G A 3: 95,760,800 (GRCm39) A34V probably damaging Het
Ptar1 A G 19: 23,686,206 (GRCm39) T173A probably benign Het
Resf1 A G 6: 149,227,352 (GRCm39) N133D possibly damaging Het
Rest G T 5: 77,416,277 (GRCm39) E164* probably null Het
Rnpepl1 A C 1: 92,847,468 (GRCm39) D685A Het
Sc5d T C 9: 42,170,008 (GRCm39) N71S probably damaging Het
Serpinb3c A T 1: 107,200,425 (GRCm39) S239R probably damaging Het
Slc28a3 C T 13: 58,758,653 (GRCm39) probably benign Het
Smagp T C 15: 100,519,844 (GRCm39) Y60C probably damaging Het
Spink10 T A 18: 62,790,939 (GRCm39) M75K probably benign Het
Spryd7 T C 14: 61,777,639 (GRCm39) N147S probably benign Het
Svil C A 18: 5,099,661 (GRCm39) H1732Q probably damaging Het
Tgoln1 T C 6: 72,592,911 (GRCm39) T190A probably benign Het
Tmem63c C T 12: 87,108,305 (GRCm39) S106F possibly damaging Het
Trpv5 T C 6: 41,637,456 (GRCm39) D375G probably null Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Ugt2b38 A G 5: 87,558,209 (GRCm39) L484P probably damaging Het
Uox A T 3: 146,330,308 (GRCm39) T179S possibly damaging Het
Usp34 A G 11: 23,317,529 (GRCm39) I882V Het
Vmn2r124 A G 17: 18,293,581 (GRCm39) K556R probably benign Het
Vmn2r57 A G 7: 41,077,089 (GRCm39) F359S probably benign Het
Wasf2 T C 4: 132,921,766 (GRCm39) V295A unknown Het
Znhit1 G A 5: 137,015,785 (GRCm39) probably benign Het
Zscan22 C T 7: 12,640,866 (GRCm39) T370M probably damaging Het
Other mutations in Steap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Steap4 APN 5 8,026,979 (GRCm39) missense probably damaging 1.00
IGL00827:Steap4 APN 5 8,026,712 (GRCm39) missense probably damaging 1.00
IGL01481:Steap4 APN 5 8,026,858 (GRCm39) missense probably damaging 0.98
IGL02378:Steap4 APN 5 8,026,741 (GRCm39) missense probably benign 0.00
IGL03058:Steap4 APN 5 8,025,664 (GRCm39) missense probably benign 0.00
PIT4362001:Steap4 UTSW 5 8,030,337 (GRCm39) missense probably benign 0.03
R0329:Steap4 UTSW 5 8,025,829 (GRCm39) missense possibly damaging 0.92
R0546:Steap4 UTSW 5 8,025,870 (GRCm39) missense probably damaging 0.99
R0637:Steap4 UTSW 5 8,028,398 (GRCm39) splice site probably benign
R0638:Steap4 UTSW 5 8,027,030 (GRCm39) splice site probably benign
R0651:Steap4 UTSW 5 8,030,348 (GRCm39) nonsense probably null
R0881:Steap4 UTSW 5 8,030,388 (GRCm39) missense probably benign
R1167:Steap4 UTSW 5 8,026,520 (GRCm39) missense probably benign 0.34
R1543:Steap4 UTSW 5 8,025,902 (GRCm39) splice site probably benign
R1889:Steap4 UTSW 5 8,025,892 (GRCm39) missense probably damaging 1.00
R3803:Steap4 UTSW 5 8,026,979 (GRCm39) missense probably damaging 1.00
R3811:Steap4 UTSW 5 8,027,017 (GRCm39) missense probably benign 0.18
R3885:Steap4 UTSW 5 8,030,494 (GRCm39) missense probably damaging 1.00
R3887:Steap4 UTSW 5 8,030,494 (GRCm39) missense probably damaging 1.00
R4051:Steap4 UTSW 5 8,030,404 (GRCm39) missense probably damaging 1.00
R4208:Steap4 UTSW 5 8,030,404 (GRCm39) missense probably damaging 1.00
R5016:Steap4 UTSW 5 8,026,699 (GRCm39) nonsense probably null
R5302:Steap4 UTSW 5 8,025,547 (GRCm39) nonsense probably null
R5951:Steap4 UTSW 5 8,025,769 (GRCm39) missense probably benign 0.00
R6136:Steap4 UTSW 5 8,028,562 (GRCm39) missense probably damaging 0.99
R6527:Steap4 UTSW 5 8,028,502 (GRCm39) missense probably damaging 0.99
R6631:Steap4 UTSW 5 8,026,995 (GRCm39) nonsense probably null
R6964:Steap4 UTSW 5 8,025,568 (GRCm39) missense probably damaging 1.00
R7055:Steap4 UTSW 5 8,026,858 (GRCm39) missense probably damaging 1.00
R7408:Steap4 UTSW 5 8,028,453 (GRCm39) missense probably benign 0.07
R7692:Steap4 UTSW 5 8,026,976 (GRCm39) missense probably benign 0.32
R8205:Steap4 UTSW 5 8,026,795 (GRCm39) missense possibly damaging 0.65
R8861:Steap4 UTSW 5 8,025,672 (GRCm39) missense probably benign 0.00
R9287:Steap4 UTSW 5 8,026,683 (GRCm39) missense probably benign 0.05
R9423:Steap4 UTSW 5 8,026,720 (GRCm39) missense probably damaging 0.99
R9504:Steap4 UTSW 5 8,030,538 (GRCm39) missense probably benign 0.00
R9531:Steap4 UTSW 5 8,028,424 (GRCm39) missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GCACATGCAGATGAGTTTCC -3'
(R):5'- TGGTGTTAAATGCTTTGACCACG -3'

Sequencing Primer
(F):5'- ACATGCAGATGAGTTTCCTCTGAC -3'
(R):5'- AAATGCTTTGACCACGTGGGC -3'
Posted On 2022-08-09