Incidental Mutation 'R9566:Ist1'
ID 721607
Institutional Source Beutler Lab
Gene Symbol Ist1
Ensembl Gene ENSMUSG00000031729
Gene Name increased sodium tolerance 1 homolog (yeast)
Synonyms 2400003C14Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock # R9566 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 109671325-109693260 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 109682184 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 94 (S94T)
Ref Sequence ENSEMBL: ENSMUSP00000034164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034164]
AlphaFold Q9CX00
Predicted Effect probably benign
Transcript: ENSMUST00000034164
AA Change: S94T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034164
Gene: ENSMUSG00000031729
AA Change: S94T

DomainStartEndE-ValueType
Pfam:Ist1 12 176 4.4e-65 PFAM
low complexity region 207 226 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
internal_repeat_1 240 278 8.47e-5 PROSPERO
internal_repeat_1 294 332 8.47e-5 PROSPERO
low complexity region 333 343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with MIT-interacting motifs that interacts with components of endosomal sorting complexes required for transport (ESCRT). ESCRT functions in vesicle budding, such as that which occurs during membrane abscission in cytokinesis. There is a pseudogene for this gene on chromosome 19. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,325,854 N133D possibly damaging Het
4921509C19Rik G A 2: 151,472,306 T484I probably benign Het
4930568D16Rik C A 2: 35,354,633 E236* probably null Het
Abca13 C A 11: 9,464,927 T3998K probably damaging Het
Adam8 A G 7: 139,985,372 V643A probably benign Het
Adamtsl2 T C 2: 27,089,761 probably null Het
Akr1c18 A T 13: 4,145,204 probably null Het
Atf7ip2 C T 16: 10,227,029 S222L probably benign Het
Atp2c1 A T 9: 105,466,629 I127N probably damaging Het
Bcl11b A G 12: 107,915,525 Y844H possibly damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Btnl4 A G 17: 34,469,289 I505T probably benign Het
Cacna1b G A 2: 24,608,080 Q2024* probably null Het
Cars A G 7: 143,559,647 probably null Het
Ccne2 A G 4: 11,193,026 K49E probably benign Het
Ccnk A G 12: 108,186,436 N4S probably benign Het
Clasp1 A G 1: 118,552,071 D1027G probably benign Het
Copb1 A T 7: 114,226,762 N662K probably benign Het
Cox8b C T 7: 140,899,013 S63N probably benign Het
Cpa4 C A 6: 30,579,609 D138E probably benign Het
Dcc A G 18: 71,810,795 C262R possibly damaging Het
Dennd5a C T 7: 109,934,047 G172E probably benign Het
Dgke C T 11: 89,041,447 probably null Het
Dnah11 A G 12: 117,974,993 Y3247H possibly damaging Het
Dnajc21 T G 15: 10,463,933 I49L possibly damaging Het
Dnm1 A G 2: 32,337,999 probably null Het
Ecd A T 14: 20,343,300 Y93* probably null Het
Epm2aip1 T C 9: 111,272,739 L260P probably damaging Het
Eqtn G A 4: 94,924,948 P134S probably damaging Het
Ercc1 T A 7: 19,354,452 C243* probably null Het
Fbln2 C A 6: 91,254,531 H537N probably benign Het
Ffar2 A G 7: 30,819,422 F231S probably damaging Het
Fhod1 G A 8: 105,337,884 A172V unknown Het
Gbp8 C T 5: 105,050,933 V39M probably damaging Het
Gm5773 T C 3: 93,773,435 L138P probably damaging Het
Gtf2ird2 A G 5: 134,217,414 E838G probably damaging Het
Gucy2e C A 11: 69,228,121 V682L probably damaging Het
Hmcn1 T G 1: 150,622,909 N4073T probably benign Het
Iltifb A T 10: 118,294,955 L12H probably damaging Het
Klhl24 A T 16: 20,115,919 N381Y probably damaging Het
Krtap24-1 C T 16: 88,611,998 C80Y Het
Lcp2 T A 11: 34,050,944 D42E Het
Maats1 A G 16: 38,335,634 F76L probably damaging Het
Map1s G A 8: 70,912,936 A162T probably benign Het
Mbd5 T G 2: 49,279,509 V1564G probably damaging Het
Mettl15 A T 2: 109,093,247 S277T possibly damaging Het
Mfsd12 C G 10: 81,361,128 T177S probably benign Het
Mlxipl A G 5: 135,123,762 D244G possibly damaging Het
Mutyh G A 4: 116,816,583 V164M probably damaging Het
Mypop A G 7: 18,992,609 D167G probably benign Het
Nbeal2 C T 9: 110,628,921 V2169M probably benign Het
Nifk G T 1: 118,332,762 V259F probably damaging Het
Oasl1 A G 5: 114,928,272 T150A probably benign Het
Obox6 G A 7: 15,834,427 R175C Het
Olfr1381 T C 11: 49,552,335 V196A probably benign Het
Olfr472 T A 7: 107,903,202 C162S possibly damaging Het
Olfr494 A T 7: 108,367,576 I29F probably benign Het
Per3 A G 4: 151,028,878 F331S Het
Pitrm1 A G 13: 6,563,416 D508G probably benign Het
Plec T A 15: 76,178,590 I2427F possibly damaging Het
Prkd3 A T 17: 78,985,223 V140D probably damaging Het
Prpf3 G A 3: 95,853,488 A34V probably damaging Het
Ptar1 A G 19: 23,708,842 T173A probably benign Het
Rest G T 5: 77,268,430 E164* probably null Het
Rnpepl1 A C 1: 92,919,746 D685A Het
Sc5d T C 9: 42,258,712 N71S probably damaging Het
Serpinb3c A T 1: 107,272,695 S239R probably damaging Het
Slc28a3 C T 13: 58,610,839 probably benign Het
Smagp T C 15: 100,621,963 Y60C probably damaging Het
Spink10 T A 18: 62,657,868 M75K probably benign Het
Spryd7 T C 14: 61,540,190 N147S probably benign Het
Steap4 A G 5: 7,975,646 E69G possibly damaging Het
Svil C A 18: 5,099,661 H1732Q probably damaging Het
Tgoln1 T C 6: 72,615,928 T190A probably benign Het
Tmem63c C T 12: 87,061,531 S106F possibly damaging Het
Trpv5 T C 6: 41,660,522 D375G probably null Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ugt2b38 A G 5: 87,410,350 L484P probably damaging Het
Uox A T 3: 146,624,553 T179S possibly damaging Het
Usp34 A G 11: 23,367,529 I882V Het
Vmn2r124 A G 17: 18,073,319 K556R probably benign Het
Vmn2r57 A G 7: 41,427,665 F359S probably benign Het
Wasf2 T C 4: 133,194,455 V295A unknown Het
Znhit1 G A 5: 136,986,931 probably benign Het
Zscan22 C T 7: 12,906,939 T370M probably damaging Het
Other mutations in Ist1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Ist1 APN 8 109682611 missense probably damaging 0.99
IGL01888:Ist1 APN 8 109683768 utr 5 prime probably benign
IGL02117:Ist1 APN 8 109678952 missense probably damaging 1.00
IGL02240:Ist1 APN 8 109682204 splice site probably benign
IGL02438:Ist1 APN 8 109675370 unclassified probably benign
IGL02883:Ist1 APN 8 109683668 splice site probably benign
R0008:Ist1 UTSW 8 109676786 missense probably benign 0.04
R0008:Ist1 UTSW 8 109676786 missense probably benign 0.04
R0165:Ist1 UTSW 8 109675366 unclassified probably benign
R1835:Ist1 UTSW 8 109678883 missense probably damaging 1.00
R6974:Ist1 UTSW 8 109677652 missense probably damaging 0.98
R7092:Ist1 UTSW 8 109682596 critical splice donor site probably null
R7395:Ist1 UTSW 8 109677527 missense probably benign
R8303:Ist1 UTSW 8 109683780 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTGTGTACAAGATACCCAGCTC -3'
(R):5'- TCCCAAGGATCTTTTGCCTG -3'

Sequencing Primer
(F):5'- CAGGCTAGGCATGATGGCATTTC -3'
(R):5'- ACCCTGAAGTCCAGTGTCTCAG -3'
Posted On 2022-08-09