Incidental Mutation 'R9567:Dars'
ID 721645
Institutional Source Beutler Lab
Gene Symbol Dars
Ensembl Gene ENSMUSG00000026356
Gene Name aspartyl-tRNA synthetase
Synonyms 5730439G15Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock # R9567 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 128363707-128417368 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128415375 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 35 (I35V)
Ref Sequence ENSEMBL: ENSMUSP00000027602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027602] [ENSMUST00000064309]
AlphaFold Q922B2
Predicted Effect
SMART Domains Protein: ENSMUSP00000027602
Gene: ENSMUSG00000026356
AA Change: I35V

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 60 145 4.6e-10 PFAM
Pfam:tRNA-synt_2 175 496 2.3e-77 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000064309
AA Change: I35V

PolyPhen 2 Score 0.706 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000066866
Gene: ENSMUSG00000026356
AA Change: I35V

DomainStartEndE-ValueType
PDB:4J15|B 1 72 7e-39 PDB
SCOP:d1eova1 25 72 1e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a multienzyme complex that functions in mediating the attachment of amino acids to their cognate tRNAs. The encoded protein ligates L-aspartate to tRNA(Asp). Mutations in this gene have been found in patients showing hypomyelination with brainstem and spinal cord involvement and leg spasticity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele die between E11 and E14. Mice heterozygous for the allele exhibit decreased PPI. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik C T 13: 119,466,257 P52S probably damaging Het
6820408C15Rik C A 2: 152,428,947 P30Q probably damaging Het
Adam18 C T 8: 24,628,194 V569I probably benign Het
Adnp2 A T 18: 80,130,918 L92Q probably damaging Het
Ahi1 C T 10: 20,981,401 H632Y possibly damaging Het
Akap9 A G 5: 4,077,311 N3720D possibly damaging Het
Alpk3 T C 7: 81,092,939 S835P possibly damaging Het
Amer3 C T 1: 34,588,755 L692F probably benign Het
Anks6 T A 4: 47,044,880 D342V unknown Het
Arap2 G T 5: 62,604,498 F1628L probably benign Het
Arhgap21 T G 2: 20,892,142 I108L possibly damaging Het
BC005561 T A 5: 104,521,778 S1389T probably benign Het
Cacna1h T C 17: 25,393,513 I404V probably damaging Het
Cacna2d3 G T 14: 28,905,311 A1077E probably benign Het
Cacng6 T C 7: 3,434,765 V203A probably benign Het
Clec1b A T 6: 129,405,238 D226V possibly damaging Het
Crb1 A C 1: 139,243,470 S727R probably benign Het
Ddo T A 10: 40,647,917 V301D probably damaging Het
Diablo C A 5: 123,524,133 probably benign Het
Dnhd1 C A 7: 105,704,266 H2875Q probably benign Het
E230025N22Rik A G 18: 36,687,283 L282P Het
Ebna1bp2 A G 4: 118,620,993 Q21R probably benign Het
Exoc7 C T 11: 116,304,898 V93I probably benign Het
Fam69a T A 5: 107,909,502 K397* probably null Het
Foxk1 T A 5: 142,401,958 Y145* probably null Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Fsip2 C T 2: 82,967,829 T489M probably benign Het
Gbf1 C T 19: 46,271,607 T1067I Het
Ggta1 T A 2: 35,423,321 T3S possibly damaging Het
Gm14124 A T 2: 150,267,597 H69L possibly damaging Het
Guf1 T A 5: 69,564,608 V370E possibly damaging Het
Hmg20a A G 9: 56,477,188 S81G probably benign Het
Igf2r G A 17: 12,686,754 T2230I probably damaging Het
Ighmbp2 A T 19: 3,282,785 M1K probably null Het
Klhdc9 T C 1: 171,360,346 T106A probably benign Het
Kti12 T C 4: 108,848,738 M283T possibly damaging Het
Lrig3 C T 10: 126,010,095 P798S probably benign Het
Lrp8 T C 4: 107,854,272 F333L probably damaging Het
Lyn T A 4: 3,746,757 D178E probably benign Het
Magi1 G A 6: 93,678,450 A1405V probably damaging Het
Magi1 A C 6: 93,682,950 probably null Het
Mdga1 G A 17: 29,857,595 P68S probably damaging Het
Mfsd8 T C 3: 40,839,498 S25G probably benign Het
Mgat1 C A 11: 49,261,867 S392R probably benign Het
Mtmr2 C T 9: 13,802,005 Q493* probably null Het
Myocd A T 11: 65,187,584 S462T probably damaging Het
Ndnf A G 6: 65,704,180 Y481C probably damaging Het
Neb G T 2: 52,175,126 R6258S probably damaging Het
Nlrp4c A G 7: 6,060,625 M11V probably benign Het
Nup93 T C 8: 94,308,976 S658P possibly damaging Het
Obox2 T A 7: 15,396,846 M1K probably null Het
Olfr1117-ps1 T A 2: 87,284,693 Y134* probably null Het
Olfr379-ps1 G T 11: 73,433,963 H88N unknown Het
Olfr610 C T 7: 103,506,520 R142H probably benign Het
Olfr979 T A 9: 40,001,071 H52L possibly damaging Het
Pcdh18 T A 3: 49,756,435 I144F possibly damaging Het
Pcdhgb5 C T 18: 37,731,929 T259I probably damaging Het
Pclo A G 5: 14,713,422 T685A Het
Pecam1 T C 11: 106,697,295 T139A possibly damaging Het
Pi15 T A 1: 17,624,954 L265Q probably damaging Het
Pkd1l3 T A 8: 109,667,541 F2053L probably damaging Het
Ppp1r36 A G 12: 76,439,126 I353V probably benign Het
Ppp1r9a A G 6: 5,157,004 S961G probably benign Het
Rbm42 T C 7: 30,645,970 R151G possibly damaging Het
Rnf224 T C 2: 25,236,342 probably benign Het
Scn2a C T 2: 65,688,630 T400I probably damaging Het
Slc17a5 T A 9: 78,538,280 Q457L possibly damaging Het
Slc5a4a A T 10: 76,186,562 D577V probably benign Het
Stim2 A G 5: 54,075,365 D123G probably damaging Het
Stxbp5l A G 16: 37,241,372 F359L probably benign Het
Syne1 T C 10: 5,246,386 D3882G possibly damaging Het
Synj1 G T 16: 90,994,024 S83Y possibly damaging Het
Tfip11 C T 5: 112,331,163 T199I probably damaging Het
Tiam1 T A 16: 89,794,765 D1349V probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ucn3 T A 13: 3,941,313 D113V probably damaging Het
Ugt3a1 A G 15: 9,306,284 D173G possibly damaging Het
Uimc1 C A 13: 55,040,614 R544L possibly damaging Het
Unc13c T C 9: 73,629,203 S1623G probably damaging Het
Vmn2r41 T C 7: 8,138,392 N691S probably benign Het
Wdr24 T A 17: 25,824,216 M4K probably damaging Het
Wdr48 T C 9: 119,912,388 F332L probably benign Het
Xpo7 A G 14: 70,666,026 V1080A probably benign Het
Zc3h3 A T 15: 75,779,412 I653N probably damaging Het
Zfp362 T A 4: 128,794,888 M1L unknown Het
Zfp503 A G 14: 21,985,973 C292R possibly damaging Het
Other mutations in Dars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Dars APN 1 128415344 splice site probably benign
IGL02260:Dars APN 1 128372161 missense probably benign 0.19
IGL03264:Dars APN 1 128413690 missense probably damaging 1.00
R0308:Dars UTSW 1 128364259 missense probably damaging 1.00
R0609:Dars UTSW 1 128405381 missense probably benign 0.00
R1148:Dars UTSW 1 128366909 splice site probably benign
R1598:Dars UTSW 1 128373972 missense probably benign 0.00
R2092:Dars UTSW 1 128374018 missense probably damaging 1.00
R2140:Dars UTSW 1 128372162 missense probably benign 0.00
R2196:Dars UTSW 1 128378858 missense probably damaging 1.00
R4735:Dars UTSW 1 128376234 nonsense probably null
R5294:Dars UTSW 1 128364302 missense probably benign 0.02
R5521:Dars UTSW 1 128373973 missense probably benign 0.01
R6137:Dars UTSW 1 128368439 missense probably benign 0.44
R6784:Dars UTSW 1 128391347 missense probably damaging 1.00
R6899:Dars UTSW 1 128413746 missense possibly damaging 0.83
R7284:Dars UTSW 1 128372267 missense probably benign
R7437:Dars UTSW 1 128372204 missense possibly damaging 0.46
R7562:Dars UTSW 1 128367026 missense possibly damaging 0.86
R8169:Dars UTSW 1 128376265 missense probably null
R8223:Dars UTSW 1 128372224 missense probably benign 0.06
R9027:Dars UTSW 1 128368426 missense possibly damaging 0.47
R9192:Dars UTSW 1 128372152 missense probably benign 0.03
R9377:Dars UTSW 1 128417208 missense probably benign
R9712:Dars UTSW 1 128405462 missense probably benign 0.00
Z1176:Dars UTSW 1 128372207 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCTGAGGGTTTAAAGAGATCTGG -3'
(R):5'- ACCTGGGAGTACTATTATGCATG -3'

Sequencing Primer
(F):5'- GTTCAAGACCAGCCTGGGTAATTC -3'
(R):5'- GCACATACATAAGTGAACAAATTTCC -3'
Posted On 2022-08-09