Incidental Mutation 'R9567:Slc5a4a'
ID 721702
Institutional Source Beutler Lab
Gene Symbol Slc5a4a
Ensembl Gene ENSMUSG00000020229
Gene Name solute carrier family 5, member 4a
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R9567 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 76147451-76189265 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 76186562 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 577 (D577V)
Ref Sequence ENSEMBL: ENSMUSP00000020450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020450]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000020450
AA Change: D577V

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020450
Gene: ENSMUSG00000020229
AA Change: D577V

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Pfam:SSF 58 492 4e-161 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 636 655 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik C T 13: 119,466,257 P52S probably damaging Het
6820408C15Rik C A 2: 152,428,947 P30Q probably damaging Het
Adam18 C T 8: 24,628,194 V569I probably benign Het
Adnp2 A T 18: 80,130,918 L92Q probably damaging Het
Ahi1 C T 10: 20,981,401 H632Y possibly damaging Het
Akap9 A G 5: 4,077,311 N3720D possibly damaging Het
Alpk3 T C 7: 81,092,939 S835P possibly damaging Het
Amer3 C T 1: 34,588,755 L692F probably benign Het
Anks6 T A 4: 47,044,880 D342V unknown Het
Arap2 G T 5: 62,604,498 F1628L probably benign Het
Arhgap21 T G 2: 20,892,142 I108L possibly damaging Het
BC005561 T A 5: 104,521,778 S1389T probably benign Het
Cacna1h T C 17: 25,393,513 I404V probably damaging Het
Cacna2d3 G T 14: 28,905,311 A1077E probably benign Het
Cacng6 T C 7: 3,434,765 V203A probably benign Het
Clec1b A T 6: 129,405,238 D226V possibly damaging Het
Crb1 A C 1: 139,243,470 S727R probably benign Het
Dars T C 1: 128,415,375 I35V Het
Ddo T A 10: 40,647,917 V301D probably damaging Het
Diablo C A 5: 123,524,133 probably benign Het
Dnhd1 C A 7: 105,704,266 H2875Q probably benign Het
E230025N22Rik A G 18: 36,687,283 L282P Het
Ebna1bp2 A G 4: 118,620,993 Q21R probably benign Het
Exoc7 C T 11: 116,304,898 V93I probably benign Het
Fam69a T A 5: 107,909,502 K397* probably null Het
Foxk1 T A 5: 142,401,958 Y145* probably null Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Fsip2 C T 2: 82,967,829 T489M probably benign Het
Gbf1 C T 19: 46,271,607 T1067I Het
Ggta1 T A 2: 35,423,321 T3S possibly damaging Het
Gm14124 A T 2: 150,267,597 H69L possibly damaging Het
Guf1 T A 5: 69,564,608 V370E possibly damaging Het
Hmg20a A G 9: 56,477,188 S81G probably benign Het
Igf2r G A 17: 12,686,754 T2230I probably damaging Het
Ighmbp2 A T 19: 3,282,785 M1K probably null Het
Klhdc9 T C 1: 171,360,346 T106A probably benign Het
Kti12 T C 4: 108,848,738 M283T possibly damaging Het
Lrig3 C T 10: 126,010,095 P798S probably benign Het
Lrp8 T C 4: 107,854,272 F333L probably damaging Het
Lyn T A 4: 3,746,757 D178E probably benign Het
Magi1 G A 6: 93,678,450 A1405V probably damaging Het
Magi1 A C 6: 93,682,950 probably null Het
Mdga1 G A 17: 29,857,595 P68S probably damaging Het
Mfsd8 T C 3: 40,839,498 S25G probably benign Het
Mgat1 C A 11: 49,261,867 S392R probably benign Het
Mtmr2 C T 9: 13,802,005 Q493* probably null Het
Myocd A T 11: 65,187,584 S462T probably damaging Het
Ndnf A G 6: 65,704,180 Y481C probably damaging Het
Neb G T 2: 52,175,126 R6258S probably damaging Het
Nlrp4c A G 7: 6,060,625 M11V probably benign Het
Nup93 T C 8: 94,308,976 S658P possibly damaging Het
Obox2 T A 7: 15,396,846 M1K probably null Het
Olfr1117-ps1 T A 2: 87,284,693 Y134* probably null Het
Olfr379-ps1 G T 11: 73,433,963 H88N unknown Het
Olfr610 C T 7: 103,506,520 R142H probably benign Het
Olfr979 T A 9: 40,001,071 H52L possibly damaging Het
Pcdh18 T A 3: 49,756,435 I144F possibly damaging Het
Pcdhgb5 C T 18: 37,731,929 T259I probably damaging Het
Pclo A G 5: 14,713,422 T685A Het
Pecam1 T C 11: 106,697,295 T139A possibly damaging Het
Pi15 T A 1: 17,624,954 L265Q probably damaging Het
Pkd1l3 T A 8: 109,667,541 F2053L probably damaging Het
Ppp1r36 A G 12: 76,439,126 I353V probably benign Het
Ppp1r9a A G 6: 5,157,004 S961G probably benign Het
Rbm42 T C 7: 30,645,970 R151G possibly damaging Het
Rnf224 T C 2: 25,236,342 probably benign Het
Scn2a C T 2: 65,688,630 T400I probably damaging Het
Slc17a5 T A 9: 78,538,280 Q457L possibly damaging Het
Stim2 A G 5: 54,075,365 D123G probably damaging Het
Stxbp5l A G 16: 37,241,372 F359L probably benign Het
Syne1 T C 10: 5,246,386 D3882G possibly damaging Het
Synj1 G T 16: 90,994,024 S83Y possibly damaging Het
Tfip11 C T 5: 112,331,163 T199I probably damaging Het
Tiam1 T A 16: 89,794,765 D1349V probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ucn3 T A 13: 3,941,313 D113V probably damaging Het
Ugt3a1 A G 15: 9,306,284 D173G possibly damaging Het
Uimc1 C A 13: 55,040,614 R544L possibly damaging Het
Unc13c T C 9: 73,629,203 S1623G probably damaging Het
Vmn2r41 T C 7: 8,138,392 N691S probably benign Het
Wdr24 T A 17: 25,824,216 M4K probably damaging Het
Wdr48 T C 9: 119,912,388 F332L probably benign Het
Xpo7 A G 14: 70,666,026 V1080A probably benign Het
Zc3h3 A T 15: 75,779,412 I653N probably damaging Het
Zfp362 T A 4: 128,794,888 M1L unknown Het
Zfp503 A G 14: 21,985,973 C292R possibly damaging Het
Other mutations in Slc5a4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Slc5a4a APN 10 76163733 missense probably damaging 1.00
IGL01725:Slc5a4a APN 10 76181674 missense probably benign 0.00
IGL02629:Slc5a4a APN 10 76147579 missense unknown
IGL02976:Slc5a4a APN 10 76170693 missense possibly damaging 0.67
IGL03255:Slc5a4a APN 10 76150512 missense probably damaging 1.00
IGL03258:Slc5a4a APN 10 76150552 missense possibly damaging 0.81
R0054:Slc5a4a UTSW 10 76178197 missense probably null 0.00
R0244:Slc5a4a UTSW 10 76189152 missense possibly damaging 0.46
R0398:Slc5a4a UTSW 10 76182722 missense possibly damaging 0.46
R0799:Slc5a4a UTSW 10 76176534 missense probably benign 0.00
R1160:Slc5a4a UTSW 10 76178161 missense possibly damaging 0.52
R1471:Slc5a4a UTSW 10 76186528 missense probably damaging 0.99
R1720:Slc5a4a UTSW 10 76189269 splice site probably null
R1857:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1858:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1859:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1942:Slc5a4a UTSW 10 76147588 missense unknown
R2016:Slc5a4a UTSW 10 76153580 missense probably benign 0.00
R2316:Slc5a4a UTSW 10 76178081 splice site probably null
R3420:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3421:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3422:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3845:Slc5a4a UTSW 10 76189149 missense probably damaging 0.99
R3874:Slc5a4a UTSW 10 76181655 missense probably benign 0.42
R4523:Slc5a4a UTSW 10 76148362 missense probably damaging 0.99
R4537:Slc5a4a UTSW 10 76178095 nonsense probably null
R4538:Slc5a4a UTSW 10 76178095 nonsense probably null
R4755:Slc5a4a UTSW 10 76186564 missense probably benign 0.00
R4868:Slc5a4a UTSW 10 76178231 missense probably damaging 0.98
R5135:Slc5a4a UTSW 10 76147594 missense unknown
R5254:Slc5a4a UTSW 10 76182738 nonsense probably null
R6083:Slc5a4a UTSW 10 76147597 missense unknown
R6331:Slc5a4a UTSW 10 76178200 missense probably damaging 0.98
R7591:Slc5a4a UTSW 10 76147667 critical splice donor site probably benign
R7671:Slc5a4a UTSW 10 76147550 missense unknown
R8785:Slc5a4a UTSW 10 76150404 critical splice acceptor site probably benign
R8929:Slc5a4a UTSW 10 76170783 missense probably benign 0.27
R8993:Slc5a4a UTSW 10 76186535 missense probably benign 0.15
R9018:Slc5a4a UTSW 10 76166712 missense possibly damaging 0.67
R9474:Slc5a4a UTSW 10 76150404 critical splice acceptor site probably benign
R9648:Slc5a4a UTSW 10 76166774 missense probably damaging 1.00
Z1177:Slc5a4a UTSW 10 76166744 missense probably benign 0.01
Z1177:Slc5a4a UTSW 10 76182847 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATACTCTTCCGTGCAGCCTG -3'
(R):5'- AGCAGGCTGTATTGATATACTTGTG -3'

Sequencing Primer
(F):5'- TTTGCTAATGCTCTCTGTG -3'
(R):5'- AGGCTGTAATTCATGGGAGGG -3'
Posted On 2022-08-09