Incidental Mutation 'R9567:Cacna2d3'
ID 721714
Institutional Source Beutler Lab
Gene Symbol Cacna2d3
Ensembl Gene ENSMUSG00000021991
Gene Name calcium channel, voltage-dependent, alpha2/delta subunit 3
Synonyms alpha 2 delta-3, alpha2delta3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9567 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 28626900-29443821 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 28627268 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 1077 (A1077E)
Ref Sequence ENSEMBL: ENSMUSP00000022567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022567] [ENSMUST00000225668] [ENSMUST00000225985]
AlphaFold Q9Z1L5
Predicted Effect probably benign
Transcript: ENSMUST00000022567
AA Change: A1077E

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022567
Gene: ENSMUSG00000021991
AA Change: A1077E

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Blast:WNT1 28 103 2e-33 BLAST
Pfam:VWA_N 113 229 6.8e-40 PFAM
VWA 254 439 4.13e-24 SMART
Pfam:Cache_1 452 548 3e-32 PFAM
low complexity region 1070 1088 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225668
Predicted Effect unknown
Transcript: ENSMUST00000225985
AA Change: A250E
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have a decreased startle reflex and occasional animals show increased aggression and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik C T 13: 119,602,793 (GRCm39) P52S probably damaging Het
6820408C15Rik C A 2: 152,270,867 (GRCm39) P30Q probably damaging Het
Adam18 C T 8: 25,118,210 (GRCm39) V569I probably benign Het
Adnp2 A T 18: 80,174,133 (GRCm39) L92Q probably damaging Het
Ahi1 C T 10: 20,857,300 (GRCm39) H632Y possibly damaging Het
Akap9 A G 5: 4,127,311 (GRCm39) N3720D possibly damaging Het
Alpk3 T C 7: 80,742,687 (GRCm39) S835P possibly damaging Het
Amer3 C T 1: 34,627,836 (GRCm39) L692F probably benign Het
Anks6 T A 4: 47,044,880 (GRCm39) D342V unknown Het
Arap2 G T 5: 62,761,841 (GRCm39) F1628L probably benign Het
Arhgap21 T G 2: 20,896,953 (GRCm39) I108L possibly damaging Het
Cacna1h T C 17: 25,612,487 (GRCm39) I404V probably damaging Het
Cacng6 T C 7: 3,483,281 (GRCm39) V203A probably benign Het
Clec1b A T 6: 129,382,201 (GRCm39) D226V possibly damaging Het
Crb1 A C 1: 139,171,208 (GRCm39) S727R probably benign Het
Dars1 T C 1: 128,343,112 (GRCm39) I35V Het
Ddo T A 10: 40,523,913 (GRCm39) V301D probably damaging Het
Diablo C A 5: 123,662,196 (GRCm39) probably benign Het
Dipk1a T A 5: 108,057,368 (GRCm39) K397* probably null Het
Dnhd1 C A 7: 105,353,473 (GRCm39) H2875Q probably benign Het
E230025N22Rik A G 18: 36,820,336 (GRCm39) L282P Het
Ebna1bp2 A G 4: 118,478,190 (GRCm39) Q21R probably benign Het
Exoc7 C T 11: 116,195,724 (GRCm39) V93I probably benign Het
Foxk1 T A 5: 142,387,713 (GRCm39) Y145* probably null Het
Foxo3 C T 10: 42,073,021 (GRCm39) V499M probably damaging Het
Fsip2 C T 2: 82,798,173 (GRCm39) T489M probably benign Het
Gbf1 C T 19: 46,260,046 (GRCm39) T1067I Het
Ggta1 T A 2: 35,313,333 (GRCm39) T3S possibly damaging Het
Guf1 T A 5: 69,721,951 (GRCm39) V370E possibly damaging Het
Hmg20a A G 9: 56,384,472 (GRCm39) S81G probably benign Het
Igf2r G A 17: 12,905,641 (GRCm39) T2230I probably damaging Het
Ighmbp2 A T 19: 3,332,785 (GRCm39) M1K probably null Het
Klhdc9 T C 1: 171,187,914 (GRCm39) T106A probably benign Het
Kti12 T C 4: 108,705,935 (GRCm39) M283T possibly damaging Het
Lrig3 C T 10: 125,845,964 (GRCm39) P798S probably benign Het
Lrp8 T C 4: 107,711,469 (GRCm39) F333L probably damaging Het
Lyn T A 4: 3,746,757 (GRCm39) D178E probably benign Het
Magi1 G A 6: 93,655,431 (GRCm39) A1405V probably damaging Het
Magi1 A C 6: 93,659,931 (GRCm39) probably null Het
Mdga1 G A 17: 30,076,569 (GRCm39) P68S probably damaging Het
Mfsd8 T C 3: 40,793,933 (GRCm39) S25G probably benign Het
Mgat1 C A 11: 49,152,694 (GRCm39) S392R probably benign Het
Mtmr2 C T 9: 13,713,301 (GRCm39) Q493* probably null Het
Myocd A T 11: 65,078,410 (GRCm39) S462T probably damaging Het
Ndnf A G 6: 65,681,164 (GRCm39) Y481C probably damaging Het
Neb G T 2: 52,065,138 (GRCm39) R6258S probably damaging Het
Nlrp4c A G 7: 6,063,624 (GRCm39) M11V probably benign Het
Nup93 T C 8: 95,035,604 (GRCm39) S658P possibly damaging Het
Obox2 T A 7: 15,130,771 (GRCm39) M1K probably null Het
Or10ag55-ps1 T A 2: 87,115,037 (GRCm39) Y134* probably null Het
Or10g9 T A 9: 39,912,367 (GRCm39) H52L possibly damaging Het
Or1e20-ps1 G T 11: 73,324,789 (GRCm39) H88N unknown Het
Or51ag1 C T 7: 103,155,727 (GRCm39) R142H probably benign Het
Pcdh18 T A 3: 49,710,884 (GRCm39) I144F possibly damaging Het
Pcdhgb5 C T 18: 37,864,982 (GRCm39) T259I probably damaging Het
Pclo A G 5: 14,763,436 (GRCm39) T685A Het
Pecam1 T C 11: 106,588,121 (GRCm39) T139A possibly damaging Het
Pi15 T A 1: 17,695,178 (GRCm39) L265Q probably damaging Het
Pkd1l3 T A 8: 110,394,173 (GRCm39) F2053L probably damaging Het
Ppp1r36 A G 12: 76,485,900 (GRCm39) I353V probably benign Het
Ppp1r9a A G 6: 5,157,004 (GRCm39) S961G probably benign Het
Rbm42 T C 7: 30,345,395 (GRCm39) R151G possibly damaging Het
Rnf224 T C 2: 25,126,354 (GRCm39) probably benign Het
Scn2a C T 2: 65,518,974 (GRCm39) T400I probably damaging Het
Slc17a5 T A 9: 78,445,562 (GRCm39) Q457L possibly damaging Het
Slc5a4a A T 10: 76,022,396 (GRCm39) D577V probably benign Het
Stim2 A G 5: 54,232,707 (GRCm39) D123G probably damaging Het
Stxbp5l A G 16: 37,061,734 (GRCm39) F359L probably benign Het
Syne1 T C 10: 5,196,386 (GRCm39) D3882G possibly damaging Het
Synj1 G T 16: 90,790,912 (GRCm39) S83Y possibly damaging Het
Tfip11 C T 5: 112,479,029 (GRCm39) T199I probably damaging Het
Thoc2l T A 5: 104,669,644 (GRCm39) S1389T probably benign Het
Tiam1 T A 16: 89,591,653 (GRCm39) D1349V probably damaging Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Ucn3 T A 13: 3,991,313 (GRCm39) D113V probably damaging Het
Ugt3a1 A G 15: 9,306,370 (GRCm39) D173G possibly damaging Het
Uimc1 C A 13: 55,188,427 (GRCm39) R544L possibly damaging Het
Unc13c T C 9: 73,536,485 (GRCm39) S1623G probably damaging Het
Vmn2r41 T C 7: 8,141,391 (GRCm39) N691S probably benign Het
Wdr24 T A 17: 26,043,190 (GRCm39) M4K probably damaging Het
Wdr48 T C 9: 119,741,454 (GRCm39) F332L probably benign Het
Xpo7 A G 14: 70,903,466 (GRCm39) V1080A probably benign Het
Zc3h3 A T 15: 75,651,261 (GRCm39) I653N probably damaging Het
Zfp1005 A T 2: 150,109,517 (GRCm39) H69L possibly damaging Het
Zfp362 T A 4: 128,688,681 (GRCm39) M1L unknown Het
Zfp503 A G 14: 22,036,041 (GRCm39) C292R possibly damaging Het
Other mutations in Cacna2d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cacna2d3 APN 14 29,022,688 (GRCm39) splice site probably benign
IGL01150:Cacna2d3 APN 14 28,905,598 (GRCm39) missense possibly damaging 0.95
IGL01390:Cacna2d3 APN 14 28,665,548 (GRCm39) missense possibly damaging 0.91
IGL01626:Cacna2d3 APN 14 28,665,564 (GRCm39) missense possibly damaging 0.90
IGL02127:Cacna2d3 APN 14 28,785,832 (GRCm39) unclassified probably benign
IGL02237:Cacna2d3 APN 14 29,068,954 (GRCm39) missense probably benign 0.09
IGL02274:Cacna2d3 APN 14 28,678,827 (GRCm39) splice site probably null
IGL02604:Cacna2d3 APN 14 29,015,066 (GRCm39) missense possibly damaging 0.61
IGL02806:Cacna2d3 APN 14 29,073,907 (GRCm39) splice site probably null
IGL02838:Cacna2d3 APN 14 29,022,785 (GRCm39) critical splice acceptor site probably null
IGL02894:Cacna2d3 APN 14 28,786,276 (GRCm39) critical splice acceptor site probably null
IGL03061:Cacna2d3 APN 14 28,780,388 (GRCm39) missense probably damaging 0.98
IGL03117:Cacna2d3 APN 14 29,189,909 (GRCm39) missense probably damaging 1.00
IGL03265:Cacna2d3 APN 14 28,674,243 (GRCm39) missense probably damaging 0.98
IGL03266:Cacna2d3 APN 14 29,022,705 (GRCm39) missense probably benign 0.01
IGL03396:Cacna2d3 APN 14 29,442,834 (GRCm39) nonsense probably null
R0094:Cacna2d3 UTSW 14 28,892,460 (GRCm39) critical splice donor site probably null
R0326:Cacna2d3 UTSW 14 28,767,601 (GRCm39) missense probably damaging 0.96
R0485:Cacna2d3 UTSW 14 29,256,476 (GRCm39) missense possibly damaging 0.89
R0669:Cacna2d3 UTSW 14 29,189,906 (GRCm39) missense probably benign 0.40
R0730:Cacna2d3 UTSW 14 28,704,322 (GRCm39) missense probably benign 0.02
R0736:Cacna2d3 UTSW 14 28,780,585 (GRCm39) missense probably benign 0.02
R1073:Cacna2d3 UTSW 14 28,767,580 (GRCm39) missense probably damaging 0.99
R1116:Cacna2d3 UTSW 14 28,786,278 (GRCm39) splice site probably benign
R1312:Cacna2d3 UTSW 14 28,767,625 (GRCm39) missense probably benign 0.00
R1467:Cacna2d3 UTSW 14 29,055,736 (GRCm39) missense possibly damaging 0.67
R1467:Cacna2d3 UTSW 14 29,055,736 (GRCm39) missense possibly damaging 0.67
R1501:Cacna2d3 UTSW 14 28,703,137 (GRCm39) missense probably damaging 1.00
R1525:Cacna2d3 UTSW 14 28,694,199 (GRCm39) missense probably benign 0.01
R1574:Cacna2d3 UTSW 14 29,073,779 (GRCm39) missense probably damaging 1.00
R1574:Cacna2d3 UTSW 14 29,073,779 (GRCm39) missense probably damaging 1.00
R1866:Cacna2d3 UTSW 14 28,691,171 (GRCm39) missense probably damaging 1.00
R2403:Cacna2d3 UTSW 14 28,627,259 (GRCm39) missense probably benign 0.38
R2981:Cacna2d3 UTSW 14 28,785,875 (GRCm39) missense probably damaging 1.00
R3715:Cacna2d3 UTSW 14 29,068,880 (GRCm39) missense probably damaging 1.00
R3791:Cacna2d3 UTSW 14 28,905,538 (GRCm39) missense probably benign 0.03
R3847:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R3849:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R3850:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R4558:Cacna2d3 UTSW 14 28,825,670 (GRCm39) missense possibly damaging 0.70
R4594:Cacna2d3 UTSW 14 28,704,303 (GRCm39) missense probably benign 0.13
R4681:Cacna2d3 UTSW 14 29,015,092 (GRCm39) missense probably damaging 1.00
R4868:Cacna2d3 UTSW 14 28,678,743 (GRCm39) splice site probably null
R4965:Cacna2d3 UTSW 14 28,704,289 (GRCm39) missense probably benign 0.07
R5133:Cacna2d3 UTSW 14 29,015,135 (GRCm39) missense possibly damaging 0.75
R5311:Cacna2d3 UTSW 14 29,068,987 (GRCm39) missense probably damaging 0.99
R5432:Cacna2d3 UTSW 14 28,665,512 (GRCm39) critical splice donor site probably null
R5873:Cacna2d3 UTSW 14 29,442,891 (GRCm39) missense probably benign 0.31
R6103:Cacna2d3 UTSW 14 29,118,446 (GRCm39) missense probably damaging 1.00
R6197:Cacna2d3 UTSW 14 28,630,278 (GRCm39) missense probably benign 0.38
R6396:Cacna2d3 UTSW 14 29,118,522 (GRCm39) missense probably benign 0.03
R6626:Cacna2d3 UTSW 14 28,786,143 (GRCm39) unclassified probably benign
R6632:Cacna2d3 UTSW 14 28,627,222 (GRCm39) makesense probably null
R6706:Cacna2d3 UTSW 14 28,846,642 (GRCm39) critical splice acceptor site probably null
R6765:Cacna2d3 UTSW 14 28,777,934 (GRCm39) missense probably damaging 1.00
R6945:Cacna2d3 UTSW 14 28,691,275 (GRCm39) intron probably benign
R7009:Cacna2d3 UTSW 14 28,691,322 (GRCm39) start codon destroyed probably null
R7069:Cacna2d3 UTSW 14 28,691,260 (GRCm39) intron probably benign
R7146:Cacna2d3 UTSW 14 29,443,654 (GRCm39) missense unknown
R7427:Cacna2d3 UTSW 14 28,786,232 (GRCm39) missense probably damaging 1.00
R7428:Cacna2d3 UTSW 14 28,786,232 (GRCm39) missense probably damaging 1.00
R7445:Cacna2d3 UTSW 14 28,780,575 (GRCm39) missense possibly damaging 0.88
R7505:Cacna2d3 UTSW 14 28,767,501 (GRCm39) splice site probably null
R7560:Cacna2d3 UTSW 14 28,780,378 (GRCm39) missense probably benign 0.18
R7703:Cacna2d3 UTSW 14 28,765,503 (GRCm39) missense possibly damaging 0.90
R8042:Cacna2d3 UTSW 14 28,826,995 (GRCm39) splice site probably benign
R8096:Cacna2d3 UTSW 14 28,825,657 (GRCm39) missense possibly damaging 0.62
R8280:Cacna2d3 UTSW 14 28,704,328 (GRCm39) missense probably benign 0.25
R8814:Cacna2d3 UTSW 14 28,819,772 (GRCm39) missense probably damaging 1.00
R8838:Cacna2d3 UTSW 14 28,691,220 (GRCm39) missense probably benign 0.03
R8864:Cacna2d3 UTSW 14 29,055,735 (GRCm39) missense probably damaging 1.00
R9103:Cacna2d3 UTSW 14 29,068,971 (GRCm39) missense probably damaging 1.00
R9341:Cacna2d3 UTSW 14 28,704,315 (GRCm39) missense possibly damaging 0.92
R9343:Cacna2d3 UTSW 14 28,704,315 (GRCm39) missense possibly damaging 0.92
Z1088:Cacna2d3 UTSW 14 28,786,265 (GRCm39) missense probably damaging 0.99
Z1177:Cacna2d3 UTSW 14 29,069,120 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TTCACATTTGCATGACTGGC -3'
(R):5'- AAATCCGTGTCCTTCCATCG -3'

Sequencing Primer
(F):5'- CTGTTAGAGTTTCTATCACGCACAG -3'
(R):5'- TTCCATCGCTGAGTCAGAAG -3'
Posted On 2022-08-09