Incidental Mutation 'R9567:Ugt3a1'
ID 721716
Institutional Source Beutler Lab
Gene Symbol Ugt3a1
Ensembl Gene ENSMUSG00000072664
Gene Name UDP glycosyltransferases 3 family, polypeptide A1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock # R9567 (G1)
Quality Score 163.009
Status Not validated
Chromosome 15
Chromosomal Location 9276888-9315032 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 9306284 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 173 (D173G)
Ref Sequence ENSEMBL: ENSMUSP00000022861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022861]
AlphaFold Q3UP75
Predicted Effect possibly damaging
Transcript: ENSMUST00000022861
AA Change: D173G

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022861
Gene: ENSMUSG00000072664
AA Change: D173G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:UDPGT 23 521 1.4e-98 PFAM
Pfam:Glyco_tran_28_C 300 451 3.7e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik C T 13: 119,466,257 P52S probably damaging Het
6820408C15Rik C A 2: 152,428,947 P30Q probably damaging Het
Adam18 C T 8: 24,628,194 V569I probably benign Het
Adnp2 A T 18: 80,130,918 L92Q probably damaging Het
Ahi1 C T 10: 20,981,401 H632Y possibly damaging Het
Akap9 A G 5: 4,077,311 N3720D possibly damaging Het
Alpk3 T C 7: 81,092,939 S835P possibly damaging Het
Amer3 C T 1: 34,588,755 L692F probably benign Het
Anks6 T A 4: 47,044,880 D342V unknown Het
Arap2 G T 5: 62,604,498 F1628L probably benign Het
Arhgap21 T G 2: 20,892,142 I108L possibly damaging Het
BC005561 T A 5: 104,521,778 S1389T probably benign Het
Cacna1h T C 17: 25,393,513 I404V probably damaging Het
Cacna2d3 G T 14: 28,905,311 A1077E probably benign Het
Cacng6 T C 7: 3,434,765 V203A probably benign Het
Clec1b A T 6: 129,405,238 D226V possibly damaging Het
Crb1 A C 1: 139,243,470 S727R probably benign Het
Dars T C 1: 128,415,375 I35V Het
Ddo T A 10: 40,647,917 V301D probably damaging Het
Diablo C A 5: 123,524,133 probably benign Het
Dnhd1 C A 7: 105,704,266 H2875Q probably benign Het
E230025N22Rik A G 18: 36,687,283 L282P Het
Ebna1bp2 A G 4: 118,620,993 Q21R probably benign Het
Exoc7 C T 11: 116,304,898 V93I probably benign Het
Fam69a T A 5: 107,909,502 K397* probably null Het
Foxk1 T A 5: 142,401,958 Y145* probably null Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Fsip2 C T 2: 82,967,829 T489M probably benign Het
Gbf1 C T 19: 46,271,607 T1067I Het
Ggta1 T A 2: 35,423,321 T3S possibly damaging Het
Gm14124 A T 2: 150,267,597 H69L possibly damaging Het
Guf1 T A 5: 69,564,608 V370E possibly damaging Het
Hmg20a A G 9: 56,477,188 S81G probably benign Het
Igf2r G A 17: 12,686,754 T2230I probably damaging Het
Ighmbp2 A T 19: 3,282,785 M1K probably null Het
Klhdc9 T C 1: 171,360,346 T106A probably benign Het
Kti12 T C 4: 108,848,738 M283T possibly damaging Het
Lrig3 C T 10: 126,010,095 P798S probably benign Het
Lrp8 T C 4: 107,854,272 F333L probably damaging Het
Lyn T A 4: 3,746,757 D178E probably benign Het
Magi1 G A 6: 93,678,450 A1405V probably damaging Het
Magi1 A C 6: 93,682,950 probably null Het
Mdga1 G A 17: 29,857,595 P68S probably damaging Het
Mfsd8 T C 3: 40,839,498 S25G probably benign Het
Mgat1 C A 11: 49,261,867 S392R probably benign Het
Mtmr2 C T 9: 13,802,005 Q493* probably null Het
Myocd A T 11: 65,187,584 S462T probably damaging Het
Ndnf A G 6: 65,704,180 Y481C probably damaging Het
Neb G T 2: 52,175,126 R6258S probably damaging Het
Nlrp4c A G 7: 6,060,625 M11V probably benign Het
Nup93 T C 8: 94,308,976 S658P possibly damaging Het
Obox2 T A 7: 15,396,846 M1K probably null Het
Olfr1117-ps1 T A 2: 87,284,693 Y134* probably null Het
Olfr379-ps1 G T 11: 73,433,963 H88N unknown Het
Olfr610 C T 7: 103,506,520 R142H probably benign Het
Olfr979 T A 9: 40,001,071 H52L possibly damaging Het
Pcdh18 T A 3: 49,756,435 I144F possibly damaging Het
Pcdhgb5 C T 18: 37,731,929 T259I probably damaging Het
Pclo A G 5: 14,713,422 T685A Het
Pecam1 T C 11: 106,697,295 T139A possibly damaging Het
Pi15 T A 1: 17,624,954 L265Q probably damaging Het
Pkd1l3 T A 8: 109,667,541 F2053L probably damaging Het
Ppp1r36 A G 12: 76,439,126 I353V probably benign Het
Ppp1r9a A G 6: 5,157,004 S961G probably benign Het
Rbm42 T C 7: 30,645,970 R151G possibly damaging Het
Rnf224 T C 2: 25,236,342 probably benign Het
Scn2a C T 2: 65,688,630 T400I probably damaging Het
Slc17a5 T A 9: 78,538,280 Q457L possibly damaging Het
Slc5a4a A T 10: 76,186,562 D577V probably benign Het
Stim2 A G 5: 54,075,365 D123G probably damaging Het
Stxbp5l A G 16: 37,241,372 F359L probably benign Het
Syne1 T C 10: 5,246,386 D3882G possibly damaging Het
Synj1 G T 16: 90,994,024 S83Y possibly damaging Het
Tfip11 C T 5: 112,331,163 T199I probably damaging Het
Tiam1 T A 16: 89,794,765 D1349V probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ucn3 T A 13: 3,941,313 D113V probably damaging Het
Uimc1 C A 13: 55,040,614 R544L possibly damaging Het
Unc13c T C 9: 73,629,203 S1623G probably damaging Het
Vmn2r41 T C 7: 8,138,392 N691S probably benign Het
Wdr24 T A 17: 25,824,216 M4K probably damaging Het
Wdr48 T C 9: 119,912,388 F332L probably benign Het
Xpo7 A G 14: 70,666,026 V1080A probably benign Het
Zc3h3 A T 15: 75,779,412 I653N probably damaging Het
Zfp362 T A 4: 128,794,888 M1L unknown Het
Zfp503 A G 14: 21,985,973 C292R possibly damaging Het
Other mutations in Ugt3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00912:Ugt3a1 APN 15 9310612 missense probably damaging 1.00
IGL01752:Ugt3a1 APN 15 9306146 missense probably damaging 1.00
IGL02438:Ugt3a1 APN 15 9291976 missense possibly damaging 0.90
PIT4354001:Ugt3a1 UTSW 15 9306360 nonsense probably null
R0127:Ugt3a1 UTSW 15 9306256 missense probably benign 0.01
R0647:Ugt3a1 UTSW 15 9310549 missense probably benign 0.00
R0841:Ugt3a1 UTSW 15 9306128 missense probably benign 0.07
R1395:Ugt3a1 UTSW 15 9306292 missense possibly damaging 0.92
R1616:Ugt3a1 UTSW 15 9306244 nonsense probably null
R2338:Ugt3a1 UTSW 15 9291973 splice site probably benign
R3797:Ugt3a1 UTSW 15 9310641 nonsense probably null
R4305:Ugt3a1 UTSW 15 9306274 missense possibly damaging 0.92
R4385:Ugt3a1 UTSW 15 9306479 missense probably benign 0.15
R4572:Ugt3a1 UTSW 15 9306393 missense probably benign 0.00
R4611:Ugt3a1 UTSW 15 9306400 nonsense probably null
R4744:Ugt3a1 UTSW 15 9310553 missense probably benign 0.36
R5715:Ugt3a1 UTSW 15 9306344 missense probably damaging 0.96
R6036:Ugt3a1 UTSW 15 9306086 missense probably benign 0.01
R6036:Ugt3a1 UTSW 15 9306086 missense probably benign 0.01
R6156:Ugt3a1 UTSW 15 9310676 missense possibly damaging 0.83
R6228:Ugt3a1 UTSW 15 9310640 missense possibly damaging 0.81
R6344:Ugt3a1 UTSW 15 9306231 missense probably damaging 0.98
R6380:Ugt3a1 UTSW 15 9306455 missense probably benign 0.00
R6383:Ugt3a1 UTSW 15 9306455 missense probably benign 0.00
R6737:Ugt3a1 UTSW 15 9311809 missense probably benign 0.30
R6848:Ugt3a1 UTSW 15 9280052 splice site probably null
R6937:Ugt3a1 UTSW 15 9292072 missense probably benign 0.00
R7061:Ugt3a1 UTSW 15 9306154 missense probably benign 0.12
R7672:Ugt3a1 UTSW 15 9310693 nonsense probably null
R7840:Ugt3a1 UTSW 15 9311817 missense probably damaging 1.00
R7945:Ugt3a1 UTSW 15 9284175 critical splice donor site probably null
R8105:Ugt3a1 UTSW 15 9306390 missense probably benign 0.00
R8414:Ugt3a1 UTSW 15 9310583 missense possibly damaging 0.82
R8981:Ugt3a1 UTSW 15 9311928 missense probably benign 0.20
R9111:Ugt3a1 UTSW 15 9306247 missense possibly damaging 0.69
R9451:Ugt3a1 UTSW 15 9292072 missense probably benign 0.00
R9657:Ugt3a1 UTSW 15 9280047 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAATACTTTGCGGACTTATGC -3'
(R):5'- ACAGCTCAGCTTTCAGTAGAAG -3'

Sequencing Primer
(F):5'- TGCAGTCACTTATTAAGCAGAAAGG -3'
(R):5'- CTCAGCTTTCAGTAGAAGGTCAGAC -3'
Posted On 2022-08-09