Incidental Mutation 'R9567:Igf2r'
ID 721721
Institutional Source Beutler Lab
Gene Symbol Igf2r
Ensembl Gene ENSMUSG00000023830
Gene Name insulin-like growth factor 2 receptor
Synonyms M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent
Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock # R9567 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 12682406-12769664 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 12686754 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 2230 (T2230I)
Ref Sequence ENSEMBL: ENSMUSP00000024599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024599]
AlphaFold Q07113
Predicted Effect probably damaging
Transcript: ENSMUST00000024599
AA Change: T2230I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: T2230I

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
Pfam:CIMR 118 266 5.1e-21 PFAM
Pfam:CIMR 272 416 8.8e-22 PFAM
Pfam:CIMR 418 567 3.4e-53 PFAM
Pfam:CIMR 569 709 6.5e-47 PFAM
Pfam:CIMR 713 869 6.5e-34 PFAM
Pfam:CIMR 876 1020 1.9e-10 PFAM
Pfam:CIMR 1024 1171 1e-60 PFAM
Pfam:CIMR 1172 1313 1.2e-17 PFAM
Pfam:CIMR 1315 1455 2.1e-58 PFAM
Pfam:CIMR 1458 1592 1.8e-22 PFAM
Pfam:CIMR 1596 1743 9.1e-23 PFAM
Pfam:CIMR 1748 1887 2.5e-22 PFAM
FN2 1889 1935 9.51e-26 SMART
Pfam:CIMR 1939 2076 2.1e-22 PFAM
Pfam:CIMR 2230 2294 4.9e-9 PFAM
transmembrane domain 2295 2317 N/A INTRINSIC
low complexity region 2336 2363 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik C T 13: 119,466,257 P52S probably damaging Het
6820408C15Rik C A 2: 152,428,947 P30Q probably damaging Het
Adam18 C T 8: 24,628,194 V569I probably benign Het
Adnp2 A T 18: 80,130,918 L92Q probably damaging Het
Ahi1 C T 10: 20,981,401 H632Y possibly damaging Het
Akap9 A G 5: 4,077,311 N3720D possibly damaging Het
Alpk3 T C 7: 81,092,939 S835P possibly damaging Het
Amer3 C T 1: 34,588,755 L692F probably benign Het
Anks6 T A 4: 47,044,880 D342V unknown Het
Arap2 G T 5: 62,604,498 F1628L probably benign Het
Arhgap21 T G 2: 20,892,142 I108L possibly damaging Het
BC005561 T A 5: 104,521,778 S1389T probably benign Het
Cacna1h T C 17: 25,393,513 I404V probably damaging Het
Cacna2d3 G T 14: 28,905,311 A1077E probably benign Het
Cacng6 T C 7: 3,434,765 V203A probably benign Het
Clec1b A T 6: 129,405,238 D226V possibly damaging Het
Crb1 A C 1: 139,243,470 S727R probably benign Het
Dars T C 1: 128,415,375 I35V Het
Ddo T A 10: 40,647,917 V301D probably damaging Het
Diablo C A 5: 123,524,133 probably benign Het
Dnhd1 C A 7: 105,704,266 H2875Q probably benign Het
E230025N22Rik A G 18: 36,687,283 L282P Het
Ebna1bp2 A G 4: 118,620,993 Q21R probably benign Het
Exoc7 C T 11: 116,304,898 V93I probably benign Het
Fam69a T A 5: 107,909,502 K397* probably null Het
Foxk1 T A 5: 142,401,958 Y145* probably null Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Fsip2 C T 2: 82,967,829 T489M probably benign Het
Gbf1 C T 19: 46,271,607 T1067I Het
Ggta1 T A 2: 35,423,321 T3S possibly damaging Het
Gm14124 A T 2: 150,267,597 H69L possibly damaging Het
Guf1 T A 5: 69,564,608 V370E possibly damaging Het
Hmg20a A G 9: 56,477,188 S81G probably benign Het
Ighmbp2 A T 19: 3,282,785 M1K probably null Het
Klhdc9 T C 1: 171,360,346 T106A probably benign Het
Kti12 T C 4: 108,848,738 M283T possibly damaging Het
Lrig3 C T 10: 126,010,095 P798S probably benign Het
Lrp8 T C 4: 107,854,272 F333L probably damaging Het
Lyn T A 4: 3,746,757 D178E probably benign Het
Magi1 G A 6: 93,678,450 A1405V probably damaging Het
Magi1 A C 6: 93,682,950 probably null Het
Mdga1 G A 17: 29,857,595 P68S probably damaging Het
Mfsd8 T C 3: 40,839,498 S25G probably benign Het
Mgat1 C A 11: 49,261,867 S392R probably benign Het
Mtmr2 C T 9: 13,802,005 Q493* probably null Het
Myocd A T 11: 65,187,584 S462T probably damaging Het
Ndnf A G 6: 65,704,180 Y481C probably damaging Het
Neb G T 2: 52,175,126 R6258S probably damaging Het
Nlrp4c A G 7: 6,060,625 M11V probably benign Het
Nup93 T C 8: 94,308,976 S658P possibly damaging Het
Obox2 T A 7: 15,396,846 M1K probably null Het
Olfr1117-ps1 T A 2: 87,284,693 Y134* probably null Het
Olfr379-ps1 G T 11: 73,433,963 H88N unknown Het
Olfr610 C T 7: 103,506,520 R142H probably benign Het
Olfr979 T A 9: 40,001,071 H52L possibly damaging Het
Pcdh18 T A 3: 49,756,435 I144F possibly damaging Het
Pcdhgb5 C T 18: 37,731,929 T259I probably damaging Het
Pclo A G 5: 14,713,422 T685A Het
Pecam1 T C 11: 106,697,295 T139A possibly damaging Het
Pi15 T A 1: 17,624,954 L265Q probably damaging Het
Pkd1l3 T A 8: 109,667,541 F2053L probably damaging Het
Ppp1r36 A G 12: 76,439,126 I353V probably benign Het
Ppp1r9a A G 6: 5,157,004 S961G probably benign Het
Rbm42 T C 7: 30,645,970 R151G possibly damaging Het
Rnf224 T C 2: 25,236,342 probably benign Het
Scn2a C T 2: 65,688,630 T400I probably damaging Het
Slc17a5 T A 9: 78,538,280 Q457L possibly damaging Het
Slc5a4a A T 10: 76,186,562 D577V probably benign Het
Stim2 A G 5: 54,075,365 D123G probably damaging Het
Stxbp5l A G 16: 37,241,372 F359L probably benign Het
Syne1 T C 10: 5,246,386 D3882G possibly damaging Het
Synj1 G T 16: 90,994,024 S83Y possibly damaging Het
Tfip11 C T 5: 112,331,163 T199I probably damaging Het
Tiam1 T A 16: 89,794,765 D1349V probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ucn3 T A 13: 3,941,313 D113V probably damaging Het
Ugt3a1 A G 15: 9,306,284 D173G possibly damaging Het
Uimc1 C A 13: 55,040,614 R544L possibly damaging Het
Unc13c T C 9: 73,629,203 S1623G probably damaging Het
Vmn2r41 T C 7: 8,138,392 N691S probably benign Het
Wdr24 T A 17: 25,824,216 M4K probably damaging Het
Wdr48 T C 9: 119,912,388 F332L probably benign Het
Xpo7 A G 14: 70,666,026 V1080A probably benign Het
Zc3h3 A T 15: 75,779,412 I653N probably damaging Het
Zfp362 T A 4: 128,794,888 M1L unknown Het
Zfp503 A G 14: 21,985,973 C292R possibly damaging Het
Other mutations in Igf2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Igf2r APN 17 12713990 missense probably benign 0.01
IGL00534:Igf2r APN 17 12739328 missense probably damaging 0.97
IGL00902:Igf2r APN 17 12700358 missense probably damaging 0.99
IGL00903:Igf2r APN 17 12683867 missense possibly damaging 0.70
IGL01160:Igf2r APN 17 12704775 missense possibly damaging 0.73
IGL01380:Igf2r APN 17 12695374 missense probably benign 0.01
IGL01392:Igf2r APN 17 12704349 missense probably benign
IGL01557:Igf2r APN 17 12704635 missense possibly damaging 0.82
IGL01568:Igf2r APN 17 12683985 missense possibly damaging 0.93
IGL01611:Igf2r APN 17 12725415 nonsense probably null
IGL01720:Igf2r APN 17 12701313 missense probably damaging 0.99
IGL01756:Igf2r APN 17 12683822 missense probably benign
IGL01839:Igf2r APN 17 12705022 missense probably damaging 1.00
IGL01904:Igf2r APN 17 12714911 missense probably damaging 0.99
IGL01965:Igf2r APN 17 12704338 missense probably benign 0.12
IGL02083:Igf2r APN 17 12693192 nonsense probably null
IGL02095:Igf2r APN 17 12702005 missense probably damaging 0.99
IGL02183:Igf2r APN 17 12698516 unclassified probably benign
IGL02576:Igf2r APN 17 12748763 missense possibly damaging 0.90
IGL02649:Igf2r APN 17 12712087 missense possibly damaging 0.93
IGL02807:Igf2r APN 17 12719883 missense probably damaging 0.98
IGL02833:Igf2r APN 17 12692723 missense probably damaging 0.97
IGL02885:Igf2r APN 17 12694120 missense possibly damaging 0.94
IGL02990:Igf2r APN 17 12710746 splice site probably benign
IGL03080:Igf2r APN 17 12726676 missense probably benign 0.06
IGL03176:Igf2r APN 17 12716672 missense probably damaging 1.00
outlier UTSW 17 12695314 missense probably benign 0.20
NA:Igf2r UTSW 17 12691962 missense probably benign
R0165:Igf2r UTSW 17 12698527 missense probably benign 0.07
R0412:Igf2r UTSW 17 12683948 missense probably damaging 0.98
R0523:Igf2r UTSW 17 12692064 missense probably benign 0.27
R0631:Igf2r UTSW 17 12717274 splice site probably null
R0722:Igf2r UTSW 17 12715495 critical splice acceptor site probably null
R0894:Igf2r UTSW 17 12692101 missense probably benign 0.02
R1265:Igf2r UTSW 17 12694124 missense probably damaging 0.98
R1466:Igf2r UTSW 17 12717269 splice site probably benign
R1485:Igf2r UTSW 17 12691285 missense probably damaging 1.00
R1633:Igf2r UTSW 17 12726309 missense probably benign
R1693:Igf2r UTSW 17 12704316 missense probably damaging 0.97
R1751:Igf2r UTSW 17 12697441 missense possibly damaging 0.94
R1843:Igf2r UTSW 17 12704270 critical splice donor site probably null
R1981:Igf2r UTSW 17 12733903 nonsense probably null
R1994:Igf2r UTSW 17 12692738 missense probably benign
R2060:Igf2r UTSW 17 12701319 missense possibly damaging 0.92
R2108:Igf2r UTSW 17 12698251 missense probably benign 0.02
R2132:Igf2r UTSW 17 12722208 missense probably benign 0.12
R2314:Igf2r UTSW 17 12715943 missense probably benign 0.28
R2349:Igf2r UTSW 17 12722311 splice site probably null
R2696:Igf2r UTSW 17 12695344 missense possibly damaging 0.96
R2864:Igf2r UTSW 17 12686724 missense probably damaging 0.99
R2865:Igf2r UTSW 17 12686724 missense probably damaging 0.99
R3884:Igf2r UTSW 17 12709468 missense probably benign
R3930:Igf2r UTSW 17 12705829 missense probably benign 0.01
R4021:Igf2r UTSW 17 12748751 missense probably damaging 0.97
R4125:Igf2r UTSW 17 12702254 missense possibly damaging 0.93
R4342:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4343:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4345:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4760:Igf2r UTSW 17 12703465 missense possibly damaging 0.92
R4796:Igf2r UTSW 17 12684126 missense possibly damaging 0.70
R4816:Igf2r UTSW 17 12684097 missense probably damaging 0.96
R4826:Igf2r UTSW 17 12701353 missense probably damaging 0.98
R4933:Igf2r UTSW 17 12691877 splice site probably null
R4980:Igf2r UTSW 17 12703360 critical splice donor site probably null
R5389:Igf2r UTSW 17 12725416 missense probably damaging 1.00
R5473:Igf2r UTSW 17 12695314 missense probably benign 0.20
R5494:Igf2r UTSW 17 12693145 missense possibly damaging 0.74
R5619:Igf2r UTSW 17 12739334 missense probably damaging 1.00
R5738:Igf2r UTSW 17 12717367 missense probably benign 0.23
R5761:Igf2r UTSW 17 12698352 splice site probably null
R5794:Igf2r UTSW 17 12709445 missense probably benign 0.37
R6210:Igf2r UTSW 17 12714951 missense probably damaging 0.98
R6319:Igf2r UTSW 17 12714113 missense probably damaging 1.00
R6388:Igf2r UTSW 17 12683900 missense probably benign
R6396:Igf2r UTSW 17 12714090 missense probably benign 0.00
R6584:Igf2r UTSW 17 12701250 missense probably damaging 0.99
R6590:Igf2r UTSW 17 12691937 nonsense probably null
R6591:Igf2r UTSW 17 12689008 missense probably damaging 1.00
R6599:Igf2r UTSW 17 12698618 missense possibly damaging 0.85
R6690:Igf2r UTSW 17 12691937 nonsense probably null
R6691:Igf2r UTSW 17 12689008 missense probably damaging 1.00
R6752:Igf2r UTSW 17 12714944 missense probably damaging 1.00
R6816:Igf2r UTSW 17 12714082 missense probably damaging 0.99
R6841:Igf2r UTSW 17 12703376 missense probably damaging 0.97
R6877:Igf2r UTSW 17 12697341 missense probably damaging 0.97
R6950:Igf2r UTSW 17 12718718 missense probably benign
R7030:Igf2r UTSW 17 12733866 missense probably damaging 1.00
R7038:Igf2r UTSW 17 12698325 missense probably benign 0.23
R7055:Igf2r UTSW 17 12704323 missense probably damaging 0.99
R7074:Igf2r UTSW 17 12714116 missense possibly damaging 0.57
R7348:Igf2r UTSW 17 12703484 missense probably damaging 0.99
R7413:Igf2r UTSW 17 12698228 nonsense probably null
R7463:Igf2r UTSW 17 12710645 missense probably benign 0.16
R7619:Igf2r UTSW 17 12698273 missense possibly damaging 0.88
R7730:Igf2r UTSW 17 12735991 missense probably damaging 0.98
R7733:Igf2r UTSW 17 12739369 missense possibly damaging 0.90
R7881:Igf2r UTSW 17 12748704 missense probably benign
R8022:Igf2r UTSW 17 12718795 missense probably damaging 1.00
R8138:Igf2r UTSW 17 12701238 missense probably benign 0.32
R8220:Igf2r UTSW 17 12692071 missense probably benign 0.22
R8305:Igf2r UTSW 17 12733860 missense probably benign
R8359:Igf2r UTSW 17 12683861 missense probably benign
R8500:Igf2r UTSW 17 12709441 missense probably damaging 0.99
R8510:Igf2r UTSW 17 12704313 missense probably benign 0.38
R8933:Igf2r UTSW 17 12701244 missense probably damaging 0.97
R8933:Igf2r UTSW 17 12704637 missense probably damaging 1.00
R8976:Igf2r UTSW 17 12726772 missense probably damaging 1.00
R8994:Igf2r UTSW 17 12716650 missense possibly damaging 0.87
R9059:Igf2r UTSW 17 12751293 start codon destroyed probably null
R9097:Igf2r UTSW 17 12691213 missense probably damaging 1.00
R9127:Igf2r UTSW 17 12739351 missense probably damaging 0.98
R9278:Igf2r UTSW 17 12695353 missense probably damaging 1.00
R9362:Igf2r UTSW 17 12722175 missense probably benign 0.02
R9371:Igf2r UTSW 17 12705759 missense possibly damaging 0.93
R9522:Igf2r UTSW 17 12698328 missense probably benign 0.26
X0028:Igf2r UTSW 17 12704913 nonsense probably null
Z1177:Igf2r UTSW 17 12697399 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTGAACAGTCATGTGAGAGGG -3'
(R):5'- AGGTTAAAGTCGTCCCTTGC -3'

Sequencing Primer
(F):5'- AGGGACATGGGCATCACACTC -3'
(R):5'- AAAGTCGTCCCTTGCTTAGG -3'
Posted On 2022-08-09