Incidental Mutation 'R9568:Col6a6'
ID 721771
Institutional Source Beutler Lab
Gene Symbol Col6a6
Ensembl Gene ENSMUSG00000043719
Gene Name collagen, type VI, alpha 6
Synonyms E330026B02Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R9568 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 105687809-105828160 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 105780727 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 762 (T762I)
Ref Sequence ENSEMBL: ENSMUSP00000060840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060896] [ENSMUST00000098441] [ENSMUST00000166431]
AlphaFold Q8C6K9
Predicted Effect possibly damaging
Transcript: ENSMUST00000060896
AA Change: T762I

PolyPhen 2 Score 0.581 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000060840
Gene: ENSMUSG00000043719
AA Change: T762I

DomainStartEndE-ValueType
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098441
AA Change: T762I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719
AA Change: T762I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 3.3e-9 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166431
AA Change: T762I

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719
AA Change: T762I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 9.3e-10 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a T G 12: 113,544,400 V131G possibly damaging Het
Agr3 G T 12: 35,948,350 M149I probably benign Het
Alox12b T A 11: 69,164,010 C280S possibly damaging Het
Amhr2 C A 15: 102,445,519 Q16K probably benign Het
Ank1 A G 8: 23,119,365 T1387A probably benign Het
B3gnt9 A C 8: 105,253,571 F395C probably damaging Het
BC048562 A G 9: 108,445,706 D80G probably damaging Het
Ccdc65 T A 15: 98,722,938 M438K possibly damaging Het
Ccz1 T C 5: 144,001,433 R240G probably damaging Het
Cish A T 9: 107,300,394 S90C probably benign Het
Col5a2 A T 1: 45,391,838 S881T possibly damaging Het
Cpa1 A G 6: 30,640,061 K49E probably benign Het
Cpb1 T C 3: 20,266,533 probably null Het
Csmd3 A G 15: 48,287,546 S483P probably damaging Het
Cul9 G A 17: 46,520,118 T1643I possibly damaging Het
Dock2 T C 11: 34,708,811 K314E possibly damaging Het
Fam186b T G 15: 99,278,690 K773T probably damaging Het
Fancl T A 11: 26,468,672 V259E probably benign Het
Fat4 T G 3: 38,892,007 I1683S probably damaging Het
Fcamr T A 1: 130,804,619 H114Q probably damaging Het
Fndc11 T C 2: 181,222,253 F284L probably damaging Het
Galns A G 8: 122,584,910 probably null Het
Gch1 A G 14: 47,189,180 S30P probably benign Het
Gcnt3 A G 9: 70,035,064 I74T probably benign Het
Gfral A T 9: 76,197,101 C210S probably damaging Het
Gm12666 G T 4: 92,191,678 Y24* probably null Het
Gm26566 G A 4: 88,722,010 A13T unknown Het
Gm9936 A T 5: 114,857,105 D150E unknown Het
Gsn C A 2: 35,283,991 D75E probably benign Het
Ighd2-7 T C 12: 113,456,724 T5A possibly damaging Het
Ikbkap G T 4: 56,786,711 P411T probably damaging Het
Itsn1 G T 16: 91,852,894 R152L probably benign Het
Klhl3 A T 13: 58,009,312 L620Q probably damaging Het
Lpl G A 8: 68,887,583 V77M probably benign Het
Lrfn3 A T 7: 30,359,491 H436Q probably benign Het
Lrp1b A G 2: 40,679,215 C3965R Het
Lrrc2 G A 9: 110,970,160 probably null Het
Manea C A 4: 26,340,468 D165Y probably damaging Het
Myom1 A T 17: 71,087,481 Q992L probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Naip5 T C 13: 100,223,313 T472A probably benign Het
Nyap1 C T 5: 137,735,132 W546* probably null Het
Olfml3 T G 3: 103,736,966 Y129S possibly damaging Het
Olfr1346 A G 7: 6,474,335 E75G probably damaging Het
Olfr187 C A 16: 59,035,850 V296F probably damaging Het
Olfr826 T A 10: 130,179,945 I312F probably benign Het
Olfr984 A T 9: 40,100,568 D307E probably benign Het
P2rx6 A C 16: 17,567,436 probably null Het
Plxnb2 A T 15: 89,160,957 Y1095* probably null Het
Pmepa1 G A 2: 173,228,001 R216C probably damaging Het
Prodh A G 16: 18,084,755 probably benign Het
Ptch1 A G 13: 63,542,173 Y389H probably damaging Het
Ptgs2 G T 1: 150,101,091 probably null Het
Rbm14 A G 19: 4,811,436 Y25H probably damaging Het
Rfc2 T C 5: 134,593,258 L197P probably damaging Het
Rnf19b G T 4: 129,073,604 W313L probably damaging Het
Sh3rf1 G T 8: 61,372,551 A527S probably benign Het
Slc12a1 A G 2: 125,190,298 Y623C probably damaging Het
Slc25a54 T A 3: 109,098,616 W147R probably damaging Het
Slc4a1 A G 11: 102,356,854 L401P probably damaging Het
Slc4a7 A G 14: 14,796,073 probably null Het
Stab2 A G 10: 86,863,556 Y1933H probably damaging Het
Supt5 A T 7: 28,315,263 V1037E probably damaging Het
Sv2b A T 7: 75,125,680 H466Q probably benign Het
Tmco5 G A 2: 116,880,249 E17K probably damaging Het
Tmem69 G A 4: 116,554,775 S12F probably damaging Het
Trp53 C A 11: 69,587,566 Y100* probably null Het
Trpm7 A T 2: 126,822,590 H956Q probably benign Het
Tsnaxip1 G A 8: 105,842,503 R495H probably benign Het
Vmn1r237 A T 17: 21,314,515 I167F probably benign Het
Vmn1r70 A G 7: 10,634,365 D260G probably benign Het
Zbtb38 G A 9: 96,688,891 H47Y probably damaging Het
Zfp184 G T 13: 21,958,727 C201F probably benign Het
Zfp384 T A 6: 125,024,833 I147N possibly damaging Het
Other mutations in Col6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Col6a6 APN 9 105758191 critical splice acceptor site probably null
IGL00768:Col6a6 APN 9 105782412 missense probably benign 0.04
IGL00917:Col6a6 APN 9 105784254 splice site probably benign
IGL01385:Col6a6 APN 9 105783666 missense probably damaging 1.00
IGL01411:Col6a6 APN 9 105785958 nonsense probably null
IGL01508:Col6a6 APN 9 105727166 splice site probably benign
IGL01668:Col6a6 APN 9 105709271 missense probably damaging 1.00
IGL01733:Col6a6 APN 9 105709255 missense possibly damaging 0.92
IGL01932:Col6a6 APN 9 105689626 missense probably benign 0.02
IGL01934:Col6a6 APN 9 105698659 critical splice donor site probably null
IGL01944:Col6a6 APN 9 105783909 missense probably damaging 1.00
IGL01980:Col6a6 APN 9 105780985 missense probably damaging 0.96
IGL02114:Col6a6 APN 9 105767199 critical splice donor site probably null
IGL02129:Col6a6 APN 9 105736340 splice site probably benign
IGL02201:Col6a6 APN 9 105780995 missense probably damaging 1.00
IGL02335:Col6a6 APN 9 105784101 missense probably damaging 1.00
IGL02541:Col6a6 APN 9 105732216 missense probably benign 0.05
IGL02574:Col6a6 APN 9 105782191 missense probably damaging 1.00
IGL02649:Col6a6 APN 9 105727170 critical splice donor site probably null
IGL02852:Col6a6 APN 9 105784073 missense probably damaging 0.99
IGL03278:Col6a6 APN 9 105709452 missense probably benign 0.01
IGL03327:Col6a6 APN 9 105767234 missense possibly damaging 0.90
PIT4519001:Col6a6 UTSW 9 105732263 missense probably benign 0.23
R0042:Col6a6 UTSW 9 105780697 missense possibly damaging 0.89
R0046:Col6a6 UTSW 9 105748848 splice site probably benign
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0140:Col6a6 UTSW 9 105702275 missense probably damaging 1.00
R0278:Col6a6 UTSW 9 105767288 missense possibly damaging 0.87
R0281:Col6a6 UTSW 9 105784116 missense probably benign 0.13
R0382:Col6a6 UTSW 9 105755555 missense probably damaging 0.98
R0389:Col6a6 UTSW 9 105784204 missense probably benign 0.02
R0421:Col6a6 UTSW 9 105784206 missense probably benign 0.02
R0502:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0503:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0600:Col6a6 UTSW 9 105761440 missense probably damaging 1.00
R0626:Col6a6 UTSW 9 105777744 missense probably benign 0.45
R0629:Col6a6 UTSW 9 105727165 splice site probably benign
R0690:Col6a6 UTSW 9 105709486 missense probably benign 0.01
R1155:Col6a6 UTSW 9 105782090 missense possibly damaging 0.64
R1245:Col6a6 UTSW 9 105748910 missense possibly damaging 0.62
R1253:Col6a6 UTSW 9 105774303 missense probably null 0.98
R1263:Col6a6 UTSW 9 105709489 missense probably benign 0.01
R1296:Col6a6 UTSW 9 105781091 missense probably damaging 1.00
R1556:Col6a6 UTSW 9 105709473 missense possibly damaging 0.82
R1600:Col6a6 UTSW 9 105778075 missense probably damaging 1.00
R1612:Col6a6 UTSW 9 105777549 missense probably damaging 1.00
R1613:Col6a6 UTSW 9 105732211 critical splice donor site probably null
R1830:Col6a6 UTSW 9 105702270 missense probably damaging 0.99
R1858:Col6a6 UTSW 9 105781102 missense probably damaging 1.00
R1897:Col6a6 UTSW 9 105785744 missense possibly damaging 0.74
R1944:Col6a6 UTSW 9 105709384 missense probably damaging 1.00
R2366:Col6a6 UTSW 9 105755694 missense probably damaging 1.00
R2484:Col6a6 UTSW 9 105780804 missense probably damaging 0.98
R3079:Col6a6 UTSW 9 105754223 missense probably benign 0.01
R3176:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3276:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3429:Col6a6 UTSW 9 105777967 missense probably damaging 1.00
R3716:Col6a6 UTSW 9 105782174 missense probably damaging 0.98
R3809:Col6a6 UTSW 9 105780692 missense probably damaging 1.00
R3978:Col6a6 UTSW 9 105698879 missense probably damaging 0.98
R4087:Col6a6 UTSW 9 105783956 missense possibly damaging 0.68
R4382:Col6a6 UTSW 9 105783690 missense probably damaging 1.00
R4516:Col6a6 UTSW 9 105698949 missense possibly damaging 0.64
R4666:Col6a6 UTSW 9 105767342 missense possibly damaging 0.93
R4905:Col6a6 UTSW 9 105767424 missense probably damaging 1.00
R4923:Col6a6 UTSW 9 105788948 missense probably damaging 1.00
R4951:Col6a6 UTSW 9 105767198 critical splice donor site probably null
R5002:Col6a6 UTSW 9 105786093 missense probably benign 0.00
R5111:Col6a6 UTSW 9 105709474 missense possibly damaging 0.70
R5205:Col6a6 UTSW 9 105782033 missense probably damaging 0.99
R5399:Col6a6 UTSW 9 105709107 missense possibly damaging 0.50
R5475:Col6a6 UTSW 9 105774338 missense probably null 0.79
R5491:Col6a6 UTSW 9 105738236 missense probably damaging 0.98
R5758:Col6a6 UTSW 9 105761518 critical splice acceptor site probably null
R5934:Col6a6 UTSW 9 105767075 missense probably damaging 1.00
R6059:Col6a6 UTSW 9 105783917 missense probably damaging 1.00
R6284:Col6a6 UTSW 9 105727227 splice site probably null
R6425:Col6a6 UTSW 9 105698865 missense probably benign 0.21
R6464:Col6a6 UTSW 9 105788953 start codon destroyed probably null 0.60
R6469:Col6a6 UTSW 9 105698691 missense probably damaging 0.97
R6520:Col6a6 UTSW 9 105785825 missense possibly damaging 0.89
R6552:Col6a6 UTSW 9 105698913 missense probably damaging 1.00
R6750:Col6a6 UTSW 9 105783680 missense probably damaging 1.00
R6813:Col6a6 UTSW 9 105783941 missense probably benign 0.32
R7032:Col6a6 UTSW 9 105767508 missense probably damaging 0.96
R7260:Col6a6 UTSW 9 105783969 missense probably benign 0.00
R7472:Col6a6 UTSW 9 105782423 missense probably damaging 1.00
R7541:Col6a6 UTSW 9 105767324 missense probably damaging 1.00
R7640:Col6a6 UTSW 9 105785744 missense possibly damaging 0.74
R7645:Col6a6 UTSW 9 105767198 critical splice donor site probably null
R7716:Col6a6 UTSW 9 105783903 missense possibly damaging 0.84
R7866:Col6a6 UTSW 9 105689561 missense probably damaging 0.96
R7938:Col6a6 UTSW 9 105780684 nonsense probably null
R8016:Col6a6 UTSW 9 105767528 missense possibly damaging 0.73
R8043:Col6a6 UTSW 9 105699020 missense probably damaging 0.98
R8073:Col6a6 UTSW 9 105781947 missense probably benign 0.01
R8082:Col6a6 UTSW 9 105783930 nonsense probably null
R8243:Col6a6 UTSW 9 105699269 missense probably damaging 1.00
R8306:Col6a6 UTSW 9 105784073 missense probably damaging 0.96
R8324:Col6a6 UTSW 9 105755654 missense probably benign 0.25
R8384:Col6a6 UTSW 9 105755694 missense probably damaging 1.00
R8400:Col6a6 UTSW 9 105774796 missense probably damaging 1.00
R8523:Col6a6 UTSW 9 105774788 missense possibly damaging 0.71
R8842:Col6a6 UTSW 9 105777967 missense probably damaging 1.00
R8862:Col6a6 UTSW 9 105786149 missense probably damaging 1.00
R8907:Col6a6 UTSW 9 105767329 missense probably damaging 0.99
R9021:Col6a6 UTSW 9 105709546 missense possibly damaging 0.85
R9088:Col6a6 UTSW 9 105784077 missense probably damaging 0.99
R9178:Col6a6 UTSW 9 105781970 missense probably benign 0.30
R9225:Col6a6 UTSW 9 105782238 missense possibly damaging 0.75
R9340:Col6a6 UTSW 9 105774558 missense probably damaging 1.00
R9342:Col6a6 UTSW 9 105785973 missense probably benign 0.00
R9360:Col6a6 UTSW 9 105767487 missense probably benign 0.00
R9368:Col6a6 UTSW 9 105786101 missense possibly damaging 0.48
R9398:Col6a6 UTSW 9 105774626 missense probably benign 0.40
R9450:Col6a6 UTSW 9 105784174 missense probably benign
R9454:Col6a6 UTSW 9 105783860 missense probably damaging 0.99
R9458:Col6a6 UTSW 9 105709162 missense probably benign 0.01
R9563:Col6a6 UTSW 9 105695753 missense probably benign 0.02
R9613:Col6a6 UTSW 9 105739202 missense probably benign 0.07
X0022:Col6a6 UTSW 9 105699332 missense probably damaging 1.00
Z1176:Col6a6 UTSW 9 105780952 missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105728255 missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105788895 missense probably null 0.24
Predicted Primers PCR Primer
(F):5'- CTTAACTCCAAAGGTCAAAGGC -3'
(R):5'- GAAACAACCTTGACGGGCAG -3'

Sequencing Primer
(F):5'- TTTCAAGTAAGAAGCTTACAACACC -3'
(R):5'- GCAGTGCCCTGACCTTTGTG -3'
Posted On 2022-08-09