Incidental Mutation 'R9568:Plxnb2'
ID 721793
Institutional Source Beutler Lab
Gene Symbol Plxnb2
Ensembl Gene ENSMUSG00000036606
Gene Name plexin B2
Synonyms Debt, 1110007H23Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock # R9568 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 89155549-89180788 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 89160957 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1095 (Y1095*)
Ref Sequence ENSEMBL: ENSMUSP00000051731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]
AlphaFold B2RXS4
Predicted Effect probably null
Transcript: ENSMUST00000060808
AA Change: Y1095*
SMART Domains Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: Y1095*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1275 1809 1.6e-225 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109331
AA Change: Y1095*
SMART Domains Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: Y1095*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1274 1809 4.4e-251 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a T G 12: 113,544,400 V131G possibly damaging Het
Agr3 G T 12: 35,948,350 M149I probably benign Het
Alox12b T A 11: 69,164,010 C280S possibly damaging Het
Amhr2 C A 15: 102,445,519 Q16K probably benign Het
Ank1 A G 8: 23,119,365 T1387A probably benign Het
B3gnt9 A C 8: 105,253,571 F395C probably damaging Het
BC048562 A G 9: 108,445,706 D80G probably damaging Het
Ccdc65 T A 15: 98,722,938 M438K possibly damaging Het
Ccz1 T C 5: 144,001,433 R240G probably damaging Het
Cish A T 9: 107,300,394 S90C probably benign Het
Col5a2 A T 1: 45,391,838 S881T possibly damaging Het
Col6a6 G A 9: 105,780,727 T762I possibly damaging Het
Cpa1 A G 6: 30,640,061 K49E probably benign Het
Cpb1 T C 3: 20,266,533 probably null Het
Csmd3 A G 15: 48,287,546 S483P probably damaging Het
Cul9 G A 17: 46,520,118 T1643I possibly damaging Het
Dock2 T C 11: 34,708,811 K314E possibly damaging Het
Fam186b T G 15: 99,278,690 K773T probably damaging Het
Fancl T A 11: 26,468,672 V259E probably benign Het
Fat4 T G 3: 38,892,007 I1683S probably damaging Het
Fcamr T A 1: 130,804,619 H114Q probably damaging Het
Fndc11 T C 2: 181,222,253 F284L probably damaging Het
Galns A G 8: 122,584,910 probably null Het
Gch1 A G 14: 47,189,180 S30P probably benign Het
Gcnt3 A G 9: 70,035,064 I74T probably benign Het
Gfral A T 9: 76,197,101 C210S probably damaging Het
Gm12666 G T 4: 92,191,678 Y24* probably null Het
Gm26566 G A 4: 88,722,010 A13T unknown Het
Gm9936 A T 5: 114,857,105 D150E unknown Het
Gsn C A 2: 35,283,991 D75E probably benign Het
Ighd2-7 T C 12: 113,456,724 T5A possibly damaging Het
Ikbkap G T 4: 56,786,711 P411T probably damaging Het
Itsn1 G T 16: 91,852,894 R152L probably benign Het
Klhl3 A T 13: 58,009,312 L620Q probably damaging Het
Lpl G A 8: 68,887,583 V77M probably benign Het
Lrfn3 A T 7: 30,359,491 H436Q probably benign Het
Lrp1b A G 2: 40,679,215 C3965R Het
Lrrc2 G A 9: 110,970,160 probably null Het
Manea C A 4: 26,340,468 D165Y probably damaging Het
Myom1 A T 17: 71,087,481 Q992L probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Naip5 T C 13: 100,223,313 T472A probably benign Het
Nyap1 C T 5: 137,735,132 W546* probably null Het
Olfml3 T G 3: 103,736,966 Y129S possibly damaging Het
Olfr1346 A G 7: 6,474,335 E75G probably damaging Het
Olfr187 C A 16: 59,035,850 V296F probably damaging Het
Olfr826 T A 10: 130,179,945 I312F probably benign Het
Olfr984 A T 9: 40,100,568 D307E probably benign Het
P2rx6 A C 16: 17,567,436 probably null Het
Pmepa1 G A 2: 173,228,001 R216C probably damaging Het
Prodh A G 16: 18,084,755 probably benign Het
Ptch1 A G 13: 63,542,173 Y389H probably damaging Het
Ptgs2 G T 1: 150,101,091 probably null Het
Rbm14 A G 19: 4,811,436 Y25H probably damaging Het
Rfc2 T C 5: 134,593,258 L197P probably damaging Het
Rnf19b G T 4: 129,073,604 W313L probably damaging Het
Sh3rf1 G T 8: 61,372,551 A527S probably benign Het
Slc12a1 A G 2: 125,190,298 Y623C probably damaging Het
Slc25a54 T A 3: 109,098,616 W147R probably damaging Het
Slc4a1 A G 11: 102,356,854 L401P probably damaging Het
Slc4a7 A G 14: 14,796,073 probably null Het
Stab2 A G 10: 86,863,556 Y1933H probably damaging Het
Supt5 A T 7: 28,315,263 V1037E probably damaging Het
Sv2b A T 7: 75,125,680 H466Q probably benign Het
Tmco5 G A 2: 116,880,249 E17K probably damaging Het
Tmem69 G A 4: 116,554,775 S12F probably damaging Het
Trp53 C A 11: 69,587,566 Y100* probably null Het
Trpm7 A T 2: 126,822,590 H956Q probably benign Het
Tsnaxip1 G A 8: 105,842,503 R495H probably benign Het
Vmn1r237 A T 17: 21,314,515 I167F probably benign Het
Vmn1r70 A G 7: 10,634,365 D260G probably benign Het
Zbtb38 G A 9: 96,688,891 H47Y probably damaging Het
Zfp184 G T 13: 21,958,727 C201F probably benign Het
Zfp384 T A 6: 125,024,833 I147N possibly damaging Het
Other mutations in Plxnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Plxnb2 APN 15 89162366 splice site probably benign
IGL01574:Plxnb2 APN 15 89162683 splice site probably null
IGL01695:Plxnb2 APN 15 89157214 missense possibly damaging 0.96
IGL01763:Plxnb2 APN 15 89161981 splice site probably null
IGL01921:Plxnb2 APN 15 89164271 missense possibly damaging 0.78
IGL02129:Plxnb2 APN 15 89160410 missense probably benign 0.04
IGL02153:Plxnb2 APN 15 89165813 nonsense probably null
IGL02637:Plxnb2 APN 15 89164057 missense possibly damaging 0.53
IGL02892:Plxnb2 APN 15 89161222 critical splice donor site probably null
IGL03108:Plxnb2 APN 15 89158031 missense probably benign 0.32
IGL03115:Plxnb2 APN 15 89162438 splice site probably benign
P0040:Plxnb2 UTSW 15 89162935 missense probably damaging 1.00
R0022:Plxnb2 UTSW 15 89163276 critical splice donor site probably null
R0095:Plxnb2 UTSW 15 89165331 missense probably benign
R0103:Plxnb2 UTSW 15 89161769 missense possibly damaging 0.85
R0544:Plxnb2 UTSW 15 89158613 splice site probably benign
R0671:Plxnb2 UTSW 15 89157981 missense probably benign 0.14
R1279:Plxnb2 UTSW 15 89162321 missense probably benign 0.02
R1530:Plxnb2 UTSW 15 89167192 missense probably benign
R1542:Plxnb2 UTSW 15 89165921 missense probably damaging 1.00
R1610:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R1686:Plxnb2 UTSW 15 89162462 missense probably damaging 1.00
R1702:Plxnb2 UTSW 15 89161984 critical splice donor site probably null
R1996:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R1997:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R2031:Plxnb2 UTSW 15 89162810 nonsense probably null
R2049:Plxnb2 UTSW 15 89159002 missense probably damaging 1.00
R2072:Plxnb2 UTSW 15 89158451 missense probably damaging 1.00
R2076:Plxnb2 UTSW 15 89158026 missense probably damaging 1.00
R2140:Plxnb2 UTSW 15 89156562 missense probably benign 0.04
R2418:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R2419:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R3752:Plxnb2 UTSW 15 89157255 splice site probably benign
R3825:Plxnb2 UTSW 15 89166399 missense probably benign 0.05
R4154:Plxnb2 UTSW 15 89159642 missense probably damaging 0.98
R4197:Plxnb2 UTSW 15 89157018 missense probably damaging 1.00
R4385:Plxnb2 UTSW 15 89160623 missense probably damaging 0.96
R4434:Plxnb2 UTSW 15 89162803 missense probably damaging 1.00
R4678:Plxnb2 UTSW 15 89160928 missense probably benign 0.37
R4717:Plxnb2 UTSW 15 89157419 nonsense probably null
R4773:Plxnb2 UTSW 15 89166947 missense probably benign 0.06
R4905:Plxnb2 UTSW 15 89157411 missense probably damaging 1.00
R5368:Plxnb2 UTSW 15 89159593 missense possibly damaging 0.94
R5418:Plxnb2 UTSW 15 89166491 missense probably benign 0.00
R5484:Plxnb2 UTSW 15 89164209 splice site probably null
R5520:Plxnb2 UTSW 15 89167543 missense possibly damaging 0.65
R5566:Plxnb2 UTSW 15 89164020 missense probably benign 0.05
R5568:Plxnb2 UTSW 15 89157435 missense probably damaging 1.00
R5619:Plxnb2 UTSW 15 89162809 missense possibly damaging 0.92
R5685:Plxnb2 UTSW 15 89167032 missense probably damaging 1.00
R5688:Plxnb2 UTSW 15 89158696 missense probably damaging 1.00
R5809:Plxnb2 UTSW 15 89167571 missense possibly damaging 0.61
R5813:Plxnb2 UTSW 15 89160759 missense possibly damaging 0.81
R5866:Plxnb2 UTSW 15 89167572 missense probably damaging 1.00
R6016:Plxnb2 UTSW 15 89161022 missense possibly damaging 0.55
R6117:Plxnb2 UTSW 15 89158000 missense probably benign 0.04
R6187:Plxnb2 UTSW 15 89167258 missense probably damaging 1.00
R6260:Plxnb2 UTSW 15 89165291 missense probably benign 0.22
R6263:Plxnb2 UTSW 15 89161986 missense probably damaging 0.99
R6269:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
R6351:Plxnb2 UTSW 15 89157770 missense possibly damaging 0.95
R6522:Plxnb2 UTSW 15 89164426 missense probably benign 0.18
R6856:Plxnb2 UTSW 15 89164320 missense probably benign 0.27
R6930:Plxnb2 UTSW 15 89160389 missense probably benign
R7354:Plxnb2 UTSW 15 89165725 missense possibly damaging 0.92
R7513:Plxnb2 UTSW 15 89158322 critical splice acceptor site probably null
R7522:Plxnb2 UTSW 15 89161774 missense probably benign 0.20
R7730:Plxnb2 UTSW 15 89162330 missense probably benign
R7766:Plxnb2 UTSW 15 89161271 missense probably benign 0.01
R7781:Plxnb2 UTSW 15 89157022 missense possibly damaging 0.89
R8126:Plxnb2 UTSW 15 89163303 missense probably benign
R8131:Plxnb2 UTSW 15 89158713 missense probably damaging 1.00
R8372:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R8736:Plxnb2 UTSW 15 89162058 missense probably damaging 1.00
R8772:Plxnb2 UTSW 15 89162746 missense probably damaging 1.00
R9022:Plxnb2 UTSW 15 89164268 missense possibly damaging 0.59
R9044:Plxnb2 UTSW 15 89160363 splice site probably benign
R9253:Plxnb2 UTSW 15 89167812 missense probably benign
R9398:Plxnb2 UTSW 15 89160919 missense probably benign 0.02
R9562:Plxnb2 UTSW 15 89165933 missense probably damaging 1.00
R9613:Plxnb2 UTSW 15 89164293 missense probably benign 0.01
X0027:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
Z1177:Plxnb2 UTSW 15 89159096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAGAGTCATGGCTTTGTTC -3'
(R):5'- AGCAAGATCTTCATCAAGTTTTGGG -3'

Sequencing Primer
(F):5'- CCAGAGTCATGGCTTTGTTCAGATTG -3'
(R):5'- GACCCTTTCCACAGGTCGAG -3'
Posted On 2022-08-09