Incidental Mutation 'R9568:Myom1'
ID 721803
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Name myomesin 1
Synonyms skelemin, D430047A17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9568 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 71019521-71126856 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 71087481 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 992 (Q992L)
Ref Sequence ENSEMBL: ENSMUSP00000072945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
AlphaFold Q62234
PDB Structure Skelemin Immunoglobulin C2 like domain 4 [SOLUTION NMR]
Skelemin Association with alfa2b,betta3 Integrin: A Structural Model [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024847
AA Change: Q894L

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: Q894L

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073211
AA Change: Q992L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: Q992L

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179759
AA Change: Q894L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: Q894L

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a T G 12: 113,544,400 V131G possibly damaging Het
Agr3 G T 12: 35,948,350 M149I probably benign Het
Alox12b T A 11: 69,164,010 C280S possibly damaging Het
Amhr2 C A 15: 102,445,519 Q16K probably benign Het
Ank1 A G 8: 23,119,365 T1387A probably benign Het
B3gnt9 A C 8: 105,253,571 F395C probably damaging Het
BC048562 A G 9: 108,445,706 D80G probably damaging Het
Ccdc65 T A 15: 98,722,938 M438K possibly damaging Het
Ccz1 T C 5: 144,001,433 R240G probably damaging Het
Cish A T 9: 107,300,394 S90C probably benign Het
Col5a2 A T 1: 45,391,838 S881T possibly damaging Het
Col6a6 G A 9: 105,780,727 T762I possibly damaging Het
Cpa1 A G 6: 30,640,061 K49E probably benign Het
Cpb1 T C 3: 20,266,533 probably null Het
Csmd3 A G 15: 48,287,546 S483P probably damaging Het
Cul9 G A 17: 46,520,118 T1643I possibly damaging Het
Dock2 T C 11: 34,708,811 K314E possibly damaging Het
Fam186b T G 15: 99,278,690 K773T probably damaging Het
Fancl T A 11: 26,468,672 V259E probably benign Het
Fat4 T G 3: 38,892,007 I1683S probably damaging Het
Fcamr T A 1: 130,804,619 H114Q probably damaging Het
Fndc11 T C 2: 181,222,253 F284L probably damaging Het
Galns A G 8: 122,584,910 probably null Het
Gch1 A G 14: 47,189,180 S30P probably benign Het
Gcnt3 A G 9: 70,035,064 I74T probably benign Het
Gfral A T 9: 76,197,101 C210S probably damaging Het
Gm12666 G T 4: 92,191,678 Y24* probably null Het
Gm26566 G A 4: 88,722,010 A13T unknown Het
Gm9936 A T 5: 114,857,105 D150E unknown Het
Gsn C A 2: 35,283,991 D75E probably benign Het
Ighd2-7 T C 12: 113,456,724 T5A possibly damaging Het
Ikbkap G T 4: 56,786,711 P411T probably damaging Het
Itsn1 G T 16: 91,852,894 R152L probably benign Het
Klhl3 A T 13: 58,009,312 L620Q probably damaging Het
Lpl G A 8: 68,887,583 V77M probably benign Het
Lrfn3 A T 7: 30,359,491 H436Q probably benign Het
Lrp1b A G 2: 40,679,215 C3965R Het
Lrrc2 G A 9: 110,970,160 probably null Het
Manea C A 4: 26,340,468 D165Y probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Naip5 T C 13: 100,223,313 T472A probably benign Het
Nyap1 C T 5: 137,735,132 W546* probably null Het
Olfml3 T G 3: 103,736,966 Y129S possibly damaging Het
Olfr1346 A G 7: 6,474,335 E75G probably damaging Het
Olfr187 C A 16: 59,035,850 V296F probably damaging Het
Olfr826 T A 10: 130,179,945 I312F probably benign Het
Olfr984 A T 9: 40,100,568 D307E probably benign Het
P2rx6 A C 16: 17,567,436 probably null Het
Plxnb2 A T 15: 89,160,957 Y1095* probably null Het
Pmepa1 G A 2: 173,228,001 R216C probably damaging Het
Prodh A G 16: 18,084,755 probably benign Het
Ptch1 A G 13: 63,542,173 Y389H probably damaging Het
Ptgs2 G T 1: 150,101,091 probably null Het
Rbm14 A G 19: 4,811,436 Y25H probably damaging Het
Rfc2 T C 5: 134,593,258 L197P probably damaging Het
Rnf19b G T 4: 129,073,604 W313L probably damaging Het
Sh3rf1 G T 8: 61,372,551 A527S probably benign Het
Slc12a1 A G 2: 125,190,298 Y623C probably damaging Het
Slc25a54 T A 3: 109,098,616 W147R probably damaging Het
Slc4a1 A G 11: 102,356,854 L401P probably damaging Het
Slc4a7 A G 14: 14,796,073 probably null Het
Stab2 A G 10: 86,863,556 Y1933H probably damaging Het
Supt5 A T 7: 28,315,263 V1037E probably damaging Het
Sv2b A T 7: 75,125,680 H466Q probably benign Het
Tmco5 G A 2: 116,880,249 E17K probably damaging Het
Tmem69 G A 4: 116,554,775 S12F probably damaging Het
Trp53 C A 11: 69,587,566 Y100* probably null Het
Trpm7 A T 2: 126,822,590 H956Q probably benign Het
Tsnaxip1 G A 8: 105,842,503 R495H probably benign Het
Vmn1r237 A T 17: 21,314,515 I167F probably benign Het
Vmn1r70 A G 7: 10,634,365 D260G probably benign Het
Zbtb38 G A 9: 96,688,891 H47Y probably damaging Het
Zfp184 G T 13: 21,958,727 C201F probably benign Het
Zfp384 T A 6: 125,024,833 I147N possibly damaging Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71126098 missense probably damaging 1.00
IGL00845:Myom1 APN 17 71084429 missense probably damaging 1.00
IGL00904:Myom1 APN 17 71099949 splice site probably benign
IGL00928:Myom1 APN 17 71089913 missense probably damaging 1.00
IGL01025:Myom1 APN 17 71077917 missense probably damaging 1.00
IGL01548:Myom1 APN 17 71101220 splice site probably benign
IGL01588:Myom1 APN 17 71117437 missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71126178 missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71099993 missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71044476 splice site probably benign
IGL01766:Myom1 APN 17 71077288 missense probably damaging 1.00
IGL02105:Myom1 APN 17 71047716 splice site probably benign
IGL02122:Myom1 APN 17 71092137 missense probably damaging 1.00
IGL02184:Myom1 APN 17 71072137 missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71108315 nonsense probably null
IGL02486:Myom1 APN 17 71099944 splice site probably benign
IGL02501:Myom1 APN 17 71072081 critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71101098 missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71084349 missense probably damaging 1.00
IGL02719:Myom1 APN 17 71106354 splice site probably benign
IGL02945:Myom1 APN 17 71092093 splice site probably benign
IGL03086:Myom1 APN 17 71108671 missense probably damaging 1.00
IGL03218:Myom1 APN 17 71084316 missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71077365 missense probably damaging 1.00
R0130:Myom1 UTSW 17 71045755 missense probably damaging 0.98
R0133:Myom1 UTSW 17 71047787 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0352:Myom1 UTSW 17 71045749 missense possibly damaging 0.72
R0396:Myom1 UTSW 17 71034693 missense probably damaging 1.00
R0496:Myom1 UTSW 17 71084306 missense probably damaging 1.00
R0506:Myom1 UTSW 17 71092220 splice site probably benign
R0511:Myom1 UTSW 17 71084317 missense probably benign 0.22
R0600:Myom1 UTSW 17 71120648 missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71067313 missense probably damaging 0.98
R0791:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0792:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0963:Myom1 UTSW 17 71077767 missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71052719 missense probably damaging 0.98
R2102:Myom1 UTSW 17 71101029 missense probably damaging 1.00
R2158:Myom1 UTSW 17 71064597 missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71023194 missense possibly damaging 0.53
R2351:Myom1 UTSW 17 71034579 missense probably damaging 0.98
R2442:Myom1 UTSW 17 71110735 missense probably damaging 1.00
R2483:Myom1 UTSW 17 71077812 missense probably damaging 1.00
R2892:Myom1 UTSW 17 71034653 missense probably damaging 1.00
R2897:Myom1 UTSW 17 71101220 splice site probably benign
R3440:Myom1 UTSW 17 71045663 splice site probably null
R3842:Myom1 UTSW 17 71045624 missense probably damaging 1.00
R4249:Myom1 UTSW 17 71092140 missense probably damaging 1.00
R4329:Myom1 UTSW 17 71036353 missense probably damaging 1.00
R4594:Myom1 UTSW 17 71100074 missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4875:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4876:Myom1 UTSW 17 71077410 missense probably damaging 1.00
R5171:Myom1 UTSW 17 71099972 missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71109787 missense probably damaging 1.00
R5882:Myom1 UTSW 17 71110722 missense probably damaging 1.00
R5978:Myom1 UTSW 17 71117443 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6155:Myom1 UTSW 17 71108695 critical splice donor site probably null
R6261:Myom1 UTSW 17 71126137 missense probably damaging 1.00
R6284:Myom1 UTSW 17 71022892 nonsense probably null
R6313:Myom1 UTSW 17 71082488 missense probably benign
R6369:Myom1 UTSW 17 71101076 missense probably damaging 1.00
R6545:Myom1 UTSW 17 71082305 missense probably benign 0.00
R6738:Myom1 UTSW 17 71100398 splice site probably null
R6933:Myom1 UTSW 17 71052671 missense probably damaging 1.00
R7168:Myom1 UTSW 17 71089947 missense probably benign 0.00
R7286:Myom1 UTSW 17 71045549 missense possibly damaging 0.90
R7315:Myom1 UTSW 17 71080897 critical splice donor site probably null
R7672:Myom1 UTSW 17 71084240 missense possibly damaging 0.92
R7789:Myom1 UTSW 17 71117436 missense probably benign 0.03
R7898:Myom1 UTSW 17 71045752 missense probably benign 0.25
R8008:Myom1 UTSW 17 71100062 missense probably benign 0.30
R8152:Myom1 UTSW 17 71084295 missense probably damaging 0.96
R8554:Myom1 UTSW 17 71036453 missense possibly damaging 0.94
R8874:Myom1 UTSW 17 71106204 missense probably damaging 1.00
R8981:Myom1 UTSW 17 71084321 missense probably benign 0.09
R9012:Myom1 UTSW 17 71100108 missense probably benign 0.06
R9090:Myom1 UTSW 17 71067330 missense probably damaging 1.00
R9193:Myom1 UTSW 17 71036300 missense probably damaging 1.00
R9237:Myom1 UTSW 17 71101056 missense probably damaging 1.00
R9271:Myom1 UTSW 17 71067330 missense probably damaging 1.00
R9355:Myom1 UTSW 17 71077893 missense probably damaging 1.00
R9362:Myom1 UTSW 17 71036293 missense probably benign 0.00
R9440:Myom1 UTSW 17 71126334 missense probably benign 0.00
R9469:Myom1 UTSW 17 71061127 missense possibly damaging 0.79
R9612:Myom1 UTSW 17 71105480 nonsense probably null
R9645:Myom1 UTSW 17 71092209 missense probably benign 0.01
X0019:Myom1 UTSW 17 71100071 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CTGTTTAGATTACAGCAGGGATGTG -3'
(R):5'- CACAGCAAGTGGATTCCTGTCTC -3'

Sequencing Primer
(F):5'- GGTGTGACTTACAGGCTATAACC -3'
(R):5'- AGCAAGTGGATTCCTGTCTCTCAAG -3'
Posted On 2022-08-09