Incidental Mutation 'R9569:Hc'
ID 721808
Institutional Source Beutler Lab
Gene Symbol Hc
Ensembl Gene ENSMUSG00000026874
Gene Name hemolytic complement
Synonyms C5, Hfib2, He, C5a
MMRRC Submission 068966-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.492) question?
Stock # R9569 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 34873343-34951450 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34926359 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 342 (I342V)
Ref Sequence ENSEMBL: ENSMUSP00000028233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028233]
AlphaFold P06684
PDB Structure Crystal structure of the mouse C5a anaphylatoxin [X-RAY DIFFRACTION]
Crystal structure of the mouse C5a-desArg anaphylatoxin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028233
AA Change: I342V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874
AA Change: I342V

DomainStartEndE-ValueType
Pfam:A2M_N 125 219 1.8e-15 PFAM
A2M_N_2 465 612 9.83e-34 SMART
ANATO 702 736 4.73e-12 SMART
A2M 776 863 2.44e-29 SMART
Pfam:A2M_comp 1055 1306 2.3e-68 PFAM
A2M_recep 1423 1513 7.29e-28 SMART
C345C 1553 1665 1.51e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi2 T A 1: 60,503,763 (GRCm39) V356D probably damaging Het
Adgrd1 T C 5: 129,256,701 (GRCm39) V690A possibly damaging Het
Apba2 T C 7: 64,393,138 (GRCm39) M553T possibly damaging Het
Apeh C T 9: 107,971,609 (GRCm39) V13M unknown Het
Apol11b C T 15: 77,524,771 (GRCm39) E5K possibly damaging Het
Apol7e C T 15: 77,601,933 (GRCm39) T177I probably damaging Het
Bltp1 T C 3: 37,066,770 (GRCm39) M211T Het
Bub1b T C 2: 118,468,884 (GRCm39) I883T probably damaging Het
C9 T C 15: 6,489,062 (GRCm39) S140P probably damaging Het
Cbfa2t2 T A 2: 154,346,485 (GRCm39) I64N probably benign Het
Cd180 A T 13: 102,842,486 (GRCm39) I511F possibly damaging Het
Cic T C 7: 24,972,120 (GRCm39) V617A possibly damaging Het
Clca3a2 A C 3: 144,513,075 (GRCm39) probably null Het
D5Ertd579e T C 5: 36,759,979 (GRCm39) T1394A probably damaging Het
Dclk1 A T 3: 55,387,852 (GRCm39) E422D probably benign Het
Depdc5 A T 5: 33,025,321 (GRCm39) D21V probably damaging Het
Dis3l A G 9: 64,236,829 (GRCm39) F40S unknown Het
Duox1 T C 2: 122,148,971 (GRCm39) V82A probably benign Het
Dus2 T C 8: 106,771,507 (GRCm39) V211A probably damaging Het
Eif2ak4 G A 2: 118,251,316 (GRCm39) S326N probably benign Het
Fat3 A C 9: 15,830,495 (GRCm39) L153R Het
Gpx8 C T 13: 113,182,125 (GRCm39) V103I probably damaging Het
Gtf2a1l A G 17: 89,001,948 (GRCm39) D268G probably benign Het
Hsp90ab1 T A 17: 45,879,878 (GRCm39) D546V possibly damaging Het
Ifi206 T G 1: 173,314,209 (GRCm39) D77A Het
Igfbp1 A G 11: 7,147,881 (GRCm39) probably benign Het
Kdm3a T C 6: 71,584,434 (GRCm39) D559G probably benign Het
Kif2a A G 13: 107,105,246 (GRCm39) I565T probably benign Het
Krt1c T C 15: 101,724,924 (GRCm39) T229A probably damaging Het
Lcmt2 G A 2: 120,970,522 (GRCm39) A187V probably damaging Het
Mapk8ip1 A G 2: 92,217,599 (GRCm39) M241T probably benign Het
Mup15 T C 4: 61,357,875 (GRCm39) probably benign Het
Myo9b T C 8: 71,811,629 (GRCm39) V1912A probably benign Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Naip5 T C 13: 100,359,821 (GRCm39) T472A probably benign Het
Net1 A G 13: 3,938,518 (GRCm39) F123S probably benign Het
Or1j8 T C 2: 36,191,946 (GRCm39) Y132H probably damaging Het
Or52n2 C T 7: 104,542,525 (GRCm39) M103I possibly damaging Het
Or5h17 A G 16: 58,820,228 (GRCm39) Y60C probably damaging Het
Pcdhb13 T C 18: 37,576,153 (GRCm39) F177S probably damaging Het
Pclo T C 5: 14,907,065 (GRCm39) probably null Het
Perm1 A G 4: 156,303,039 (GRCm39) T528A probably benign Het
Pik3c2a C T 7: 115,957,939 (GRCm39) A1116T possibly damaging Het
Prox2 G A 12: 85,141,766 (GRCm39) Q146* probably null Het
Psd A T 19: 46,308,717 (GRCm39) C639S possibly damaging Het
Rffl T A 11: 82,703,264 (GRCm39) T220S probably benign Het
Scn2a A G 2: 65,560,622 (GRCm39) D1284G probably damaging Het
Scube1 T C 15: 83,513,605 (GRCm39) Y385C probably damaging Het
Sec14l3 A T 11: 4,026,324 (GRCm39) D388V probably damaging Het
Slc26a1 G T 5: 108,819,460 (GRCm39) Q596K probably benign Het
Slc6a19 T C 13: 73,834,030 (GRCm39) T343A probably benign Het
Slc7a4 A G 16: 17,393,262 (GRCm39) V179A Het
Sox14 T G 9: 99,757,562 (GRCm39) D49A Het
Spata31g1 G C 4: 42,971,740 (GRCm39) V358L probably benign Het
Timm22 A G 11: 76,298,196 (GRCm39) S56G probably benign Het
Tmub2 G A 11: 102,179,153 (GRCm39) W322* probably null Het
Tsc22d4 A G 5: 137,756,428 (GRCm39) T8A probably benign Het
Ttn T C 2: 76,539,652 (GRCm39) I34445V probably benign Het
Tyms A T 5: 30,268,360 (GRCm39) Y196* probably null Het
Ube2o G A 11: 116,434,823 (GRCm39) T546M probably damaging Het
Umodl1 A G 17: 31,217,143 (GRCm39) Y1125C probably damaging Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 (GRCm39) probably benign Het
Unk A T 11: 115,950,035 (GRCm39) Q747L probably damaging Het
Vmn1r170 A G 7: 23,306,294 (GRCm39) E232G probably benign Het
Vps41 A G 13: 19,013,396 (GRCm39) Y338C possibly damaging Het
Washc5 T C 15: 59,215,980 (GRCm39) M800V probably benign Het
Wt1 T A 2: 104,993,711 (GRCm39) I348N possibly damaging Het
Xirp2 A G 2: 67,341,242 (GRCm39) Y1161C probably damaging Het
Xpo7 A G 14: 70,906,140 (GRCm39) M1001T possibly damaging Het
Yeats2 A T 16: 19,972,902 (GRCm39) R19W probably damaging Het
Zfp142 T C 1: 74,615,386 (GRCm39) T476A probably damaging Het
Zfp229 T C 17: 21,964,573 (GRCm39) W268R possibly damaging Het
Zfp473 A G 7: 44,388,971 (GRCm39) F50S probably damaging Het
Zfp975 A T 7: 42,311,413 (GRCm39) M400K probably benign Het
Zkscan5 A G 5: 145,144,419 (GRCm39) M150V probably benign Het
Znfx1 T A 2: 166,897,875 (GRCm39) I350F Het
Other mutations in Hc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Hc APN 2 34,881,641 (GRCm39) missense probably benign 0.00
IGL00922:Hc APN 2 34,881,680 (GRCm39) missense probably damaging 1.00
IGL01523:Hc APN 2 34,929,250 (GRCm39) missense probably benign 0.04
IGL01746:Hc APN 2 34,947,338 (GRCm39) missense probably damaging 0.98
IGL01793:Hc APN 2 34,918,202 (GRCm39) missense probably damaging 1.00
IGL01972:Hc APN 2 34,873,784 (GRCm39) missense probably damaging 1.00
IGL02037:Hc APN 2 34,903,531 (GRCm39) missense probably benign 0.16
IGL02048:Hc APN 2 34,886,039 (GRCm39) missense probably benign 0.00
IGL02227:Hc APN 2 34,899,923 (GRCm39) intron probably benign
IGL02230:Hc APN 2 34,903,682 (GRCm39) missense probably benign
IGL02254:Hc APN 2 34,874,836 (GRCm39) missense probably damaging 1.00
IGL02363:Hc APN 2 34,890,847 (GRCm39) missense probably benign
IGL02650:Hc APN 2 34,890,886 (GRCm39) missense possibly damaging 0.49
IGL03053:Hc APN 2 34,914,210 (GRCm39) missense probably benign 0.07
IGL03168:Hc APN 2 34,914,210 (GRCm39) missense probably benign 0.07
IGL03341:Hc APN 2 34,893,389 (GRCm39) missense probably damaging 0.98
PIT4142001:Hc UTSW 2 34,921,833 (GRCm39) splice site probably benign
PIT4378001:Hc UTSW 2 34,921,876 (GRCm39) missense probably benign 0.13
PIT4508001:Hc UTSW 2 34,874,816 (GRCm39) missense probably damaging 0.96
PIT4812001:Hc UTSW 2 34,919,464 (GRCm39) missense probably benign 0.16
R0025:Hc UTSW 2 34,876,304 (GRCm39) missense probably damaging 1.00
R0053:Hc UTSW 2 34,947,287 (GRCm39) missense probably benign 0.32
R0197:Hc UTSW 2 34,874,762 (GRCm39) missense probably damaging 1.00
R0218:Hc UTSW 2 34,918,086 (GRCm39) missense probably damaging 1.00
R0242:Hc UTSW 2 34,926,166 (GRCm39) splice site probably benign
R0496:Hc UTSW 2 34,903,583 (GRCm39) missense probably damaging 1.00
R1205:Hc UTSW 2 34,893,536 (GRCm39) missense possibly damaging 0.50
R1468:Hc UTSW 2 34,873,819 (GRCm39) nonsense probably null
R1468:Hc UTSW 2 34,873,819 (GRCm39) nonsense probably null
R1574:Hc UTSW 2 34,890,777 (GRCm39) intron probably benign
R1610:Hc UTSW 2 34,896,173 (GRCm39) missense probably benign 0.44
R1640:Hc UTSW 2 34,947,336 (GRCm39) nonsense probably null
R1887:Hc UTSW 2 34,924,623 (GRCm39) missense probably benign
R1920:Hc UTSW 2 34,919,407 (GRCm39) splice site probably benign
R2018:Hc UTSW 2 34,903,540 (GRCm39) missense probably damaging 1.00
R2019:Hc UTSW 2 34,903,540 (GRCm39) missense probably damaging 1.00
R2151:Hc UTSW 2 34,881,115 (GRCm39) intron probably benign
R2366:Hc UTSW 2 34,903,648 (GRCm39) missense probably benign
R4093:Hc UTSW 2 34,873,819 (GRCm39) nonsense probably null
R4288:Hc UTSW 2 34,920,414 (GRCm39) missense probably damaging 0.98
R4501:Hc UTSW 2 34,887,488 (GRCm39) splice site probably null
R4502:Hc UTSW 2 34,896,264 (GRCm39) missense probably benign 0.00
R4508:Hc UTSW 2 34,903,077 (GRCm39) missense possibly damaging 0.94
R4583:Hc UTSW 2 34,918,189 (GRCm39) missense probably benign 0.00
R4686:Hc UTSW 2 34,929,260 (GRCm39) missense possibly damaging 0.49
R4776:Hc UTSW 2 34,929,746 (GRCm39) missense probably benign 0.12
R4846:Hc UTSW 2 34,909,682 (GRCm39) missense probably benign 0.00
R5032:Hc UTSW 2 34,903,544 (GRCm39) missense probably benign 0.07
R5089:Hc UTSW 2 34,914,902 (GRCm39) missense probably benign 0.01
R5289:Hc UTSW 2 34,886,026 (GRCm39) critical splice donor site probably null
R5347:Hc UTSW 2 34,927,636 (GRCm39) missense probably benign 0.04
R5356:Hc UTSW 2 34,885,007 (GRCm39) missense probably benign 0.00
R5379:Hc UTSW 2 34,881,077 (GRCm39) missense probably damaging 1.00
R5403:Hc UTSW 2 34,947,446 (GRCm39) missense probably damaging 1.00
R5418:Hc UTSW 2 34,898,195 (GRCm39) critical splice donor site probably null
R5450:Hc UTSW 2 34,903,050 (GRCm39) missense possibly damaging 0.67
R5494:Hc UTSW 2 34,893,551 (GRCm39) splice site probably null
R5713:Hc UTSW 2 34,903,543 (GRCm39) missense probably damaging 0.99
R5898:Hc UTSW 2 34,887,449 (GRCm39) missense probably benign 0.06
R5925:Hc UTSW 2 34,920,462 (GRCm39) missense possibly damaging 0.92
R5942:Hc UTSW 2 34,918,137 (GRCm39) nonsense probably null
R5991:Hc UTSW 2 34,896,117 (GRCm39) missense possibly damaging 0.91
R6036:Hc UTSW 2 34,929,696 (GRCm39) missense probably benign 0.00
R6036:Hc UTSW 2 34,929,696 (GRCm39) missense probably benign 0.00
R6115:Hc UTSW 2 34,903,050 (GRCm39) missense probably damaging 1.00
R6234:Hc UTSW 2 34,918,058 (GRCm39) missense probably benign
R6264:Hc UTSW 2 34,896,285 (GRCm39) critical splice acceptor site probably null
R6313:Hc UTSW 2 34,879,851 (GRCm39) splice site probably null
R6525:Hc UTSW 2 34,881,236 (GRCm39) missense probably benign 0.06
R6577:Hc UTSW 2 34,922,138 (GRCm39) missense probably benign 0.00
R6601:Hc UTSW 2 34,935,906 (GRCm39) missense probably benign 0.03
R6916:Hc UTSW 2 34,900,044 (GRCm39) nonsense probably null
R7108:Hc UTSW 2 34,929,706 (GRCm39) missense probably benign 0.03
R7143:Hc UTSW 2 34,940,450 (GRCm39) missense probably benign 0.00
R7388:Hc UTSW 2 34,874,859 (GRCm39) splice site probably null
R7468:Hc UTSW 2 34,918,063 (GRCm39) missense probably benign 0.00
R7504:Hc UTSW 2 34,951,331 (GRCm39) missense not run
R7521:Hc UTSW 2 34,935,344 (GRCm39) missense possibly damaging 0.80
R7582:Hc UTSW 2 34,881,278 (GRCm39) missense possibly damaging 0.70
R7596:Hc UTSW 2 34,890,859 (GRCm39) missense probably damaging 0.96
R7599:Hc UTSW 2 34,940,431 (GRCm39) missense probably damaging 1.00
R7692:Hc UTSW 2 34,914,161 (GRCm39) missense probably damaging 1.00
R7853:Hc UTSW 2 34,900,045 (GRCm39) missense probably damaging 1.00
R7877:Hc UTSW 2 34,887,411 (GRCm39) nonsense probably null
R8329:Hc UTSW 2 34,902,910 (GRCm39) splice site probably null
R8375:Hc UTSW 2 34,873,731 (GRCm39) missense probably benign 0.32
R8477:Hc UTSW 2 34,879,182 (GRCm39) missense probably damaging 1.00
R8810:Hc UTSW 2 34,909,535 (GRCm39) missense probably benign 0.06
R8888:Hc UTSW 2 34,890,861 (GRCm39) missense probably benign 0.00
R8895:Hc UTSW 2 34,890,861 (GRCm39) missense probably benign 0.00
R8968:Hc UTSW 2 34,922,317 (GRCm39) missense possibly damaging 0.91
R8969:Hc UTSW 2 34,909,475 (GRCm39) critical splice donor site probably null
R9146:Hc UTSW 2 34,924,571 (GRCm39) missense probably damaging 1.00
R9218:Hc UTSW 2 34,922,203 (GRCm39) missense probably damaging 1.00
R9340:Hc UTSW 2 34,876,294 (GRCm39) missense probably damaging 0.99
R9396:Hc UTSW 2 34,927,615 (GRCm39) nonsense probably null
R9576:Hc UTSW 2 34,873,767 (GRCm39) missense probably benign 0.01
R9706:Hc UTSW 2 34,914,196 (GRCm39) missense probably damaging 1.00
X0066:Hc UTSW 2 34,873,723 (GRCm39) missense probably damaging 1.00
Z1088:Hc UTSW 2 34,919,482 (GRCm39) missense probably benign 0.02
Z1088:Hc UTSW 2 34,898,261 (GRCm39) missense possibly damaging 0.94
Z1176:Hc UTSW 2 34,896,285 (GRCm39) critical splice acceptor site probably null
Z1177:Hc UTSW 2 34,903,622 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCCTGTTTGCCAGAAC -3'
(R):5'- TCTACAGGCGCTTTGGAAG -3'

Sequencing Primer
(F):5'- GCCTGTTTGCCAGAACAATTCAG -3'
(R):5'- TGGAAGCTCCCGACTCTTG -3'
Posted On 2022-08-09