Mutagenetix > Incidental Mutation

Incidental Mutation 'R9569:4932438A13Rik'

721821

Institutional Source

Beutler Lab

Gene Symbol

4932438A13Rik

Ensembl Gene

ENSMUSG00000037270

Gene Name

RIKEN cDNA 4932438A13 gene

Synonyms

Tweek, FSA

MMRRC Submission

068966-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9569 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

36863104-37053033 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 37012621 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 211 (M211T)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057272] [ENSMUST00000138950] [ENSMUST00000152564]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000057272

SMART Domains

Protein: ENSMUSP00000060199
Gene: ENSMUSG00000037270

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
low complexity region	701	716	N/A	INTRINSIC
low complexity region	767	779	N/A	INTRINSIC
low complexity region	1127	1138	N/A	INTRINSIC
low complexity region	1154	1166	N/A	INTRINSIC
low complexity region	1226	1240	N/A	INTRINSIC
low complexity region	1381	1402	N/A	INTRINSIC
low complexity region	1541	1547	N/A	INTRINSIC
low complexity region	1593	1607	N/A	INTRINSIC
low complexity region	1810	1821	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2182	2191	N/A	INTRINSIC
low complexity region	2336	2349	N/A	INTRINSIC
low complexity region	2614	2657	N/A	INTRINSIC
low complexity region	3468	3480	N/A	INTRINSIC
low complexity region	3717	3742	N/A	INTRINSIC
low complexity region	3816	3837	N/A	INTRINSIC
low complexity region	3919	3929	N/A	INTRINSIC
low complexity region	3941	3948	N/A	INTRINSIC
low complexity region	4024	4038	N/A	INTRINSIC
low complexity region	4041	4049	N/A	INTRINSIC
low complexity region	4117	4149	N/A	INTRINSIC
low complexity region	4172	4185	N/A	INTRINSIC
low complexity region	4359	4380	N/A	INTRINSIC
FSA_C	4386	4990	N/A	SMART
low complexity region	4993	5004	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000138152

SMART Domains

Protein: ENSMUSP00000117809
Gene: ENSMUSG00000037270

Domain	Start	End	E-Value	Type
low complexity region	81	106	N/A	INTRINSIC
low complexity region	180	201	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000138950

SMART Domains

Protein: ENSMUSP00000118092
Gene: ENSMUSG00000037270

Domain	Start	End	E-Value	Type
low complexity region	254	279	N/A	INTRINSIC
low complexity region	353	374	N/A	INTRINSIC
low complexity region	526	540	N/A	INTRINSIC
low complexity region	543	551	N/A	INTRINSIC
low complexity region	619	651	N/A	INTRINSIC
low complexity region	674	687	N/A	INTRINSIC
low complexity region	861	882	N/A	INTRINSIC
FSA_C	888	1492	N/A	SMART
low complexity region	1495	1506	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141740

SMART Domains

Protein: ENSMUSP00000117814
Gene: ENSMUSG00000037270

Domain	Start	End	E-Value	Type
low complexity region	28	40	N/A	INTRINSIC
low complexity region	298	323	N/A	INTRINSIC
low complexity region	397	418	N/A	INTRINSIC
low complexity region	500	510	N/A	INTRINSIC
low complexity region	522	529	N/A	INTRINSIC
low complexity region	605	619	N/A	INTRINSIC
low complexity region	622	630	N/A	INTRINSIC
low complexity region	698	730	N/A	INTRINSIC
low complexity region	753	766	N/A	INTRINSIC
low complexity region	940	961	N/A	INTRINSIC
FSA_C	967	1571	N/A	SMART
low complexity region	1574	1585	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000121356
Gene: ENSMUSG00000037270
AA Change: M211T

Domain	Start	End	E-Value	Type
low complexity region	121	133	N/A	INTRINSIC
low complexity region	167	177	N/A	INTRINSIC
low complexity region	458	483	N/A	INTRINSIC
low complexity region	557	578	N/A	INTRINSIC
low complexity region	730	744	N/A	INTRINSIC
low complexity region	747	755	N/A	INTRINSIC
low complexity region	823	855	N/A	INTRINSIC
low complexity region	878	891	N/A	INTRINSIC
low complexity region	1065	1086	N/A	INTRINSIC
FSA_C	1092	1696	N/A	SMART
low complexity region	1699	1710	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000152564

SMART Domains

Protein: ENSMUSP00000117808
Gene: ENSMUSG00000037270

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
low complexity region	701	716	N/A	INTRINSIC
low complexity region	767	779	N/A	INTRINSIC
low complexity region	1127	1138	N/A	INTRINSIC
low complexity region	1154	1166	N/A	INTRINSIC
low complexity region	1226	1240	N/A	INTRINSIC
low complexity region	1381	1402	N/A	INTRINSIC
low complexity region	1541	1547	N/A	INTRINSIC
low complexity region	1593	1607	N/A	INTRINSIC
low complexity region	1810	1821	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2182	2191	N/A	INTRINSIC
low complexity region	2336	2349	N/A	INTRINSIC
low complexity region	2614	2657	N/A	INTRINSIC
low complexity region	3468	3480	N/A	INTRINSIC
low complexity region	3717	3742	N/A	INTRINSIC
low complexity region	3816	3837	N/A	INTRINSIC
low complexity region	3919	3929	N/A	INTRINSIC
low complexity region	3941	3948	N/A	INTRINSIC
low complexity region	4024	4038	N/A	INTRINSIC
low complexity region	4041	4049	N/A	INTRINSIC
low complexity region	4117	4149	N/A	INTRINSIC
low complexity region	4172	4185	N/A	INTRINSIC
low complexity region	4359	4380	N/A	INTRINSIC
FSA_C	4386	4990	N/A	SMART
low complexity region	4993	5004	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located on the long arm of chromosome 4 in a region that is associated with susceptibility to celiac disease. The encoded protein is similar to a Chinese hamster protein that is associated with spermatocyte and adipocyte differentiation. The C-terminus of the protein is also similar to a Caenorhabditis elegans protein that plays a role in lipid storage. In mammals, this protein is thought to function in the regulation of epithelial growth and differentiation, and in tumor development. [provided by RefSeq, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	G	C	4: 42,971,740	V358L	probably benign	Het
Abi2	T	A	1: 60,464,604	V356D	probably damaging	Het
Adgrd1	T	C	5: 129,179,637	V690A	possibly damaging	Het
Apba2	T	C	7: 64,743,390	M553T	possibly damaging	Het
Apeh	C	T	9: 108,094,410	V13M	unknown	Het
Apol11b	C	T	15: 77,640,571	E5K	possibly damaging	Het
Apol7e	C	T	15: 77,717,733	T177I	probably damaging	Het
Bub1b	T	C	2: 118,638,403	I883T	probably damaging	Het
C9	T	C	15: 6,459,581	S140P	probably damaging	Het
Cbfa2t2	T	A	2: 154,504,565	I64N	probably benign	Het
Cd180	A	T	13: 102,705,978	I511F	possibly damaging	Het
Cic	T	C	7: 25,272,695	V617A	possibly damaging	Het
Clca3a2	A	C	3: 144,807,314		probably null	Het
D5Ertd579e	T	C	5: 36,602,635	T1394A	probably damaging	Het
Dclk1	A	T	3: 55,480,431	E422D	probably benign	Het
Depdc5	A	T	5: 32,867,977	D21V	probably damaging	Het
Dis3l	A	G	9: 64,329,547	F40S	unknown	Het
Duox1	T	C	2: 122,318,490	V82A	probably benign	Het
Dus2	T	C	8: 106,044,875	V211A	probably damaging	Het
Eif2ak4	G	A	2: 118,420,835	S326N	probably benign	Het
Fat3	A	C	9: 15,919,199	L153R		Het
Gpx8	C	T	13: 113,045,591	V103I	probably damaging	Het
Gtf2a1l	A	G	17: 88,694,520	D268G	probably benign	Het
Hc	T	C	2: 35,036,347	I342V	probably benign	Het
Hsp90ab1	T	A	17: 45,568,952	D546V	possibly damaging	Het
Ifi206	T	G	1: 173,486,643	D77A		Het
Igfbp1	A	G	11: 7,197,881		probably benign	Het
Kdm3a	T	C	6: 71,607,450	D559G	probably benign	Het
Kif2a	A	G	13: 106,968,738	I565T	probably benign	Het
Krt2	T	C	15: 101,816,489	T229A	probably damaging	Het
Lcmt2	G	A	2: 121,140,041	A187V	probably damaging	Het
Mapk8ip1	A	G	2: 92,387,254	M241T	probably benign	Het
Mup15	T	C	4: 61,439,638		probably benign	Het
Myo9b	T	C	8: 71,358,985	V1912A	probably benign	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Naip5	T	C	13: 100,223,313	T472A	probably benign	Het
Net1	A	G	13: 3,888,518	F123S	probably benign	Het
Olfr183	A	G	16: 58,999,865	Y60C	probably damaging	Het
Olfr335-ps	T	C	2: 36,301,934	Y132H	probably damaging	Het
Olfr666	C	T	7: 104,893,318	M103I	possibly damaging	Het
Pcdhb13	T	C	18: 37,443,100	F177S	probably damaging	Het
Pclo	T	C	5: 14,857,051		probably null	Het
Perm1	A	G	4: 156,218,582	T528A	probably benign	Het
Pik3c2a	C	T	7: 116,358,704	A1116T	possibly damaging	Het
Prox2	G	A	12: 85,094,992	Q146*	probably null	Het
Psd	A	T	19: 46,320,278	C639S	possibly damaging	Het
Rffl	T	A	11: 82,812,438	T220S	probably benign	Het
Scn2a	A	G	2: 65,730,278	D1284G	probably damaging	Het
Scube1	T	C	15: 83,629,404	Y385C	probably damaging	Het
Sec14l3	A	T	11: 4,076,324	D388V	probably damaging	Het
Slc26a1	G	T	5: 108,671,594	Q596K	probably benign	Het
Slc6a19	T	C	13: 73,685,911	T343A	probably benign	Het
Slc7a4	A	G	16: 17,575,398	V179A		Het
Sox14	T	G	9: 99,875,509	D49A		Het
Timm22	A	G	11: 76,407,370	S56G	probably benign	Het
Tmub2	G	A	11: 102,288,327	W322*	probably null	Het
Tsc22d4	A	G	5: 137,758,166	T8A	probably benign	Het
Ttn	T	C	2: 76,709,308	I34445V	probably benign	Het
Tyms	A	T	5: 30,063,362	Y196*	probably null	Het
Ube2o	G	A	11: 116,543,997	T546M	probably damaging	Het
Umodl1	A	G	17: 30,998,169	Y1125C	probably damaging	Het
Unc13b	CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC	CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC	4: 43,177,312		probably benign	Het
Unk	A	T	11: 116,059,209	Q747L	probably damaging	Het
Vmn1r170	A	G	7: 23,606,869	E232G	probably benign	Het
Vps41	A	G	13: 18,829,226	Y338C	possibly damaging	Het
Washc5	T	C	15: 59,344,131	M800V	probably benign	Het
Wt1	T	A	2: 105,163,366	I348N	possibly damaging	Het
Xirp2	A	G	2: 67,510,898	Y1161C	probably damaging	Het
Xpo7	A	G	14: 70,668,700	M1001T	possibly damaging	Het
Yeats2	A	T	16: 20,154,152	R19W	probably damaging	Het
Zfp142	T	C	1: 74,576,227	T476A	probably damaging	Het
Zfp229	T	C	17: 21,745,592	W268R	possibly damaging	Het
Zfp473	A	G	7: 44,739,547	F50S	probably damaging	Het
Zfp975	A	T	7: 42,661,989	M400K	probably benign	Het
Zkscan5	A	G	5: 145,207,609	M150V	probably benign	Het
Znfx1	T	A	2: 167,055,955	I350F		Het

Other mutations in 4932438A13Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:4932438A13Rik	APN	3	37011727	missense	probably benign	0.00
IGL00434:4932438A13Rik	APN	3	36987299	missense	probably damaging	0.98
IGL00640:4932438A13Rik	APN	3	36908218	missense	probably damaging	1.00
IGL00693:4932438A13Rik	APN	3	37052547	utr 3 prime	probably benign
IGL00721:4932438A13Rik	APN	3	37030751	splice site	probably null
IGL00756:4932438A13Rik	APN	3	36908218	missense	probably damaging	1.00
IGL00896:4932438A13Rik	APN	3	37039462	missense	probably benign
IGL00902:4932438A13Rik	APN	3	37041345	missense	probably damaging	1.00
IGL00980:4932438A13Rik	APN	3	37000041	missense	probably damaging	1.00
IGL01019:4932438A13Rik	APN	3	37006984	critical splice acceptor site	probably null
IGL01025:4932438A13Rik	APN	3	37046280	missense	possibly damaging	0.89
IGL01306:4932438A13Rik	APN	3	37005013	splice site	probably benign
IGL01370:4932438A13Rik	APN	3	36947755	missense	probably benign	0.07
IGL01377:4932438A13Rik	APN	3	36973452	critical splice donor site	probably null
IGL01401:4932438A13Rik	APN	3	36942292	missense	probably benign
IGL01419:4932438A13Rik	APN	3	37048121	missense	probably damaging	1.00
IGL01432:4932438A13Rik	APN	3	37003759	missense	possibly damaging	0.87
IGL01433:4932438A13Rik	APN	3	36887770	missense	probably damaging	1.00
IGL01452:4932438A13Rik	APN	3	36996308	unclassified	probably benign
IGL01520:4932438A13Rik	APN	3	36973260	nonsense	probably null
IGL01524:4932438A13Rik	APN	3	36942382	missense	possibly damaging	0.90
IGL01628:4932438A13Rik	APN	3	37008485	missense	probably damaging	1.00
IGL01638:4932438A13Rik	APN	3	36974311	missense	probably damaging	1.00
IGL01650:4932438A13Rik	APN	3	36992673	splice site	probably benign
IGL01717:4932438A13Rik	APN	3	37034736	missense	probably benign
IGL01767:4932438A13Rik	APN	3	37041363	missense	probably benign	0.29
IGL01813:4932438A13Rik	APN	3	36928520	missense	possibly damaging	0.90
IGL01998:4932438A13Rik	APN	3	36957016	missense	possibly damaging	0.49
IGL02172:4932438A13Rik	APN	3	37004873	missense	probably damaging	0.99
IGL02197:4932438A13Rik	APN	3	36906735	missense	probably damaging	1.00
IGL02248:4932438A13Rik	APN	3	36969290	critical splice donor site	probably null
IGL02273:4932438A13Rik	APN	3	36921437	splice site	probably benign
IGL02403:4932438A13Rik	APN	3	37030664	missense	probably benign
IGL02492:4932438A13Rik	APN	3	37048113	missense	probably benign	0.04
IGL02517:4932438A13Rik	APN	3	36958868	missense	probably damaging	1.00
IGL02519:4932438A13Rik	APN	3	36895315	missense	probably damaging	1.00
IGL02586:4932438A13Rik	APN	3	37044608	nonsense	probably null
IGL02620:4932438A13Rik	APN	3	37035945	missense	possibly damaging	0.95
IGL02621:4932438A13Rik	APN	3	37041484	splice site	probably benign
IGL02670:4932438A13Rik	APN	3	36967305	nonsense	probably null
IGL02806:4932438A13Rik	APN	3	36946494	missense	possibly damaging	0.95
IGL02985:4932438A13Rik	APN	3	36958757	missense	probably damaging	0.99
IGL03004:4932438A13Rik	APN	3	36965677	splice site	probably benign
IGL03037:4932438A13Rik	APN	3	36969207	missense	probably benign	0.23
IGL03037:4932438A13Rik	APN	3	36969208	missense	probably damaging	1.00
IGL03062:4932438A13Rik	APN	3	37038517	splice site	probably benign
IGL03137:4932438A13Rik	APN	3	37034602	missense	probably damaging	0.98
IGL03150:4932438A13Rik	APN	3	36948066	missense	probably damaging	1.00
IGL03204:4932438A13Rik	APN	3	37050934	splice site	probably benign
IGL03207:4932438A13Rik	APN	3	36949996	missense	possibly damaging	0.73
IGL03256:4932438A13Rik	APN	3	36906683	splice site	probably benign
IGL03264:4932438A13Rik	APN	3	37002635	missense	probably damaging	1.00
IGL03265:4932438A13Rik	APN	3	37047991	missense	probably benign	0.00
IGL03303:4932438A13Rik	APN	3	36870077	missense	possibly damaging	0.90
admonished	UTSW	3	36948304	missense	probably damaging	1.00
alerted	UTSW	3	37033265	missense	possibly damaging	0.85
informed	UTSW	3	36965849	missense	probably damaging	1.00
resolved	UTSW	3	36921221	missense	possibly damaging	0.60
tipped	UTSW	3	36988085	missense	possibly damaging	0.81
warned	UTSW	3	36965621	missense	probably damaging	1.00
FR4340:4932438A13Rik	UTSW	3	37050752	critical splice acceptor site	probably benign
FR4737:4932438A13Rik	UTSW	3	37050754	critical splice acceptor site	probably benign
PIT4515001:4932438A13Rik	UTSW	3	36974236	missense	probably damaging	1.00
R0035:4932438A13Rik	UTSW	3	36987598	nonsense	probably null
R0047:4932438A13Rik	UTSW	3	36908192	missense	possibly damaging	0.83
R0047:4932438A13Rik	UTSW	3	36908192	missense	possibly damaging	0.83
R0068:4932438A13Rik	UTSW	3	36952221	missense	probably benign	0.28
R0068:4932438A13Rik	UTSW	3	36952221	missense	probably benign	0.28
R0092:4932438A13Rik	UTSW	3	37028159	missense	probably benign	0.41
R0233:4932438A13Rik	UTSW	3	36948563	nonsense	probably null
R0233:4932438A13Rik	UTSW	3	36948563	nonsense	probably null
R0256:4932438A13Rik	UTSW	3	36917773	missense	probably benign	0.01
R0277:4932438A13Rik	UTSW	3	36943182	nonsense	probably null
R0321:4932438A13Rik	UTSW	3	36906788	splice site	probably null
R0323:4932438A13Rik	UTSW	3	36943182	nonsense	probably null
R0335:4932438A13Rik	UTSW	3	36969152	missense	probably damaging	1.00
R0375:4932438A13Rik	UTSW	3	37046252	missense	probably damaging	0.99
R0437:4932438A13Rik	UTSW	3	36989804	missense	possibly damaging	0.81
R0445:4932438A13Rik	UTSW	3	37000065	missense	probably damaging	0.99
R0496:4932438A13Rik	UTSW	3	36987635	missense	probably damaging	1.00
R0531:4932438A13Rik	UTSW	3	37036825	missense	probably damaging	1.00
R0543:4932438A13Rik	UTSW	3	36996458	missense	probably benign	0.22
R0545:4932438A13Rik	UTSW	3	36987690	splice site	probably benign
R0674:4932438A13Rik	UTSW	3	37044626	missense	possibly damaging	0.86
R0745:4932438A13Rik	UTSW	3	36928463	missense	probably damaging	1.00
R0755:4932438A13Rik	UTSW	3	36946364	missense	probably damaging	1.00
R0785:4932438A13Rik	UTSW	3	36959334	splice site	probably benign
R1056:4932438A13Rik	UTSW	3	36983453	missense	possibly damaging	0.69
R1056:4932438A13Rik	UTSW	3	37044680	missense	probably benign	0.44
R1080:4932438A13Rik	UTSW	3	36988255	missense	probably damaging	1.00
R1103:4932438A13Rik	UTSW	3	36996523	missense	probably benign
R1119:4932438A13Rik	UTSW	3	36987045	missense	probably damaging	1.00
R1170:4932438A13Rik	UTSW	3	37044631	missense	probably damaging	0.98
R1183:4932438A13Rik	UTSW	3	36895303	missense	possibly damaging	0.51
R1186:4932438A13Rik	UTSW	3	36996312	unclassified	probably benign
R1201:4932438A13Rik	UTSW	3	36948375	missense	probably benign
R1219:4932438A13Rik	UTSW	3	36946470	nonsense	probably null
R1270:4932438A13Rik	UTSW	3	36952184	missense	probably damaging	1.00
R1273:4932438A13Rik	UTSW	3	36987210	missense	probably damaging	1.00
R1338:4932438A13Rik	UTSW	3	37052535	missense	unknown
R1364:4932438A13Rik	UTSW	3	36987030	missense	probably damaging	1.00
R1437:4932438A13Rik	UTSW	3	36942429	missense	possibly damaging	0.65
R1447:4932438A13Rik	UTSW	3	36965586	missense	probably damaging	0.98
R1467:4932438A13Rik	UTSW	3	37035945	missense	probably damaging	0.99
R1467:4932438A13Rik	UTSW	3	37035945	missense	probably damaging	0.99
R1470:4932438A13Rik	UTSW	3	36998331	missense	probably benign	0.31
R1470:4932438A13Rik	UTSW	3	36998331	missense	probably benign	0.31
R1481:4932438A13Rik	UTSW	3	37008434	missense	probably damaging	0.99
R1528:4932438A13Rik	UTSW	3	37052535	missense	unknown
R1533:4932438A13Rik	UTSW	3	37041375	missense	probably damaging	1.00
R1546:4932438A13Rik	UTSW	3	36870056	missense	possibly damaging	0.64
R1606:4932438A13Rik	UTSW	3	36942399	missense	probably damaging	1.00
R1638:4932438A13Rik	UTSW	3	37035812	nonsense	probably null
R1772:4932438A13Rik	UTSW	3	36959432	missense	probably damaging	1.00
R1896:4932438A13Rik	UTSW	3	36908231	nonsense	probably null
R1919:4932438A13Rik	UTSW	3	37006983	critical splice acceptor site	probably null
R1983:4932438A13Rik	UTSW	3	36887865	missense	probably null	1.00
R1987:4932438A13Rik	UTSW	3	36953985	critical splice donor site	probably null
R1992:4932438A13Rik	UTSW	3	37000032	missense	probably benign	0.32
R1999:4932438A13Rik	UTSW	3	36908211	missense	probably damaging	1.00
R2004:4932438A13Rik	UTSW	3	36895378	missense	possibly damaging	0.77
R2010:4932438A13Rik	UTSW	3	36928551	missense	probably benign	0.09
R2027:4932438A13Rik	UTSW	3	37047961	splice site	probably benign
R2039:4932438A13Rik	UTSW	3	37003878	missense	possibly damaging	0.66
R2054:4932438A13Rik	UTSW	3	36947853	missense	probably benign	0.01
R2089:4932438A13Rik	UTSW	3	36988256	missense	probably damaging	1.00
R2091:4932438A13Rik	UTSW	3	36988256	missense	probably damaging	1.00
R2091:4932438A13Rik	UTSW	3	36953970	missense	probably damaging	1.00
R2091:4932438A13Rik	UTSW	3	36988256	missense	probably damaging	1.00
R2220:4932438A13Rik	UTSW	3	36875530	critical splice donor site	probably null
R2374:4932438A13Rik	UTSW	3	36885396	missense	probably benign	0.00
R2437:4932438A13Rik	UTSW	3	36958685	splice site	probably null
R2860:4932438A13Rik	UTSW	3	36965849	missense	probably damaging	1.00
R2861:4932438A13Rik	UTSW	3	36965849	missense	probably damaging	1.00
R2909:4932438A13Rik	UTSW	3	36947953	missense	probably damaging	1.00
R2925:4932438A13Rik	UTSW	3	37007122	missense	probably damaging	0.99
R2940:4932438A13Rik	UTSW	3	36958805	missense	probably damaging	1.00
R3015:4932438A13Rik	UTSW	3	36875462	missense	probably damaging	1.00
R3086:4932438A13Rik	UTSW	3	37011703	missense	possibly damaging	0.56
R3159:4932438A13Rik	UTSW	3	36959415	missense	probably benign	0.17
R3440:4932438A13Rik	UTSW	3	37041912	nonsense	probably null
R3703:4932438A13Rik	UTSW	3	36987581	missense	probably damaging	1.00
R3705:4932438A13Rik	UTSW	3	36987581	missense	probably damaging	1.00
R3795:4932438A13Rik	UTSW	3	37030565	missense	probably benign	0.30
R3820:4932438A13Rik	UTSW	3	37040434	missense	probably damaging	1.00
R3862:4932438A13Rik	UTSW	3	36885398	missense	possibly damaging	0.73
R3944:4932438A13Rik	UTSW	3	37030061	missense	possibly damaging	0.90
R4020:4932438A13Rik	UTSW	3	37012575	intron	probably benign
R4091:4932438A13Rik	UTSW	3	37030589	missense	probably benign	0.00
R4159:4932438A13Rik	UTSW	3	36931083	missense	probably benign	0.00
R4231:4932438A13Rik	UTSW	3	36920236	missense	probably benign	0.10
R4368:4932438A13Rik	UTSW	3	36988147	nonsense	probably null
R4413:4932438A13Rik	UTSW	3	36958681	splice site	probably null
R4475:4932438A13Rik	UTSW	3	37040395	missense	probably damaging	1.00
R4488:4932438A13Rik	UTSW	3	37003933	missense	probably null	0.93
R4489:4932438A13Rik	UTSW	3	37003933	missense	probably null	0.93
R4516:4932438A13Rik	UTSW	3	36895311	missense	possibly damaging	0.90
R4580:4932438A13Rik	UTSW	3	37030025	missense	probably benign	0.02
R4672:4932438A13Rik	UTSW	3	36889990	makesense	probably null
R4705:4932438A13Rik	UTSW	3	37041889	missense	probably benign	0.03
R4735:4932438A13Rik	UTSW	3	37004967	missense	possibly damaging	0.84
R4741:4932438A13Rik	UTSW	3	36942375	missense	probably damaging	0.99
R4754:4932438A13Rik	UTSW	3	37022466	nonsense	probably null
R4778:4932438A13Rik	UTSW	3	36937065	missense	possibly damaging	0.90
R4833:4932438A13Rik	UTSW	3	36964968	missense	probably damaging	0.96
R4896:4932438A13Rik	UTSW	3	36965937	missense	probably damaging	1.00
R4910:4932438A13Rik	UTSW	3	36998199	missense	probably damaging	1.00
R4922:4932438A13Rik	UTSW	3	36987165	missense	probably damaging	1.00
R4941:4932438A13Rik	UTSW	3	36917702	missense	probably damaging	1.00
R4941:4932438A13Rik	UTSW	3	36919901	missense	probably benign	0.41
R4980:4932438A13Rik	UTSW	3	36943312	missense	probably damaging	1.00
R5030:4932438A13Rik	UTSW	3	36943399	intron	probably benign
R5049:4932438A13Rik	UTSW	3	37040506	intron	probably benign
R5049:4932438A13Rik	UTSW	3	37041390	missense	probably damaging	1.00
R5089:4932438A13Rik	UTSW	3	36987502	missense	probably benign	0.02
R5092:4932438A13Rik	UTSW	3	37000085	missense	probably benign	0.14
R5122:4932438A13Rik	UTSW	3	37034757	splice site	probably null
R5210:4932438A13Rik	UTSW	3	37033265	missense	possibly damaging	0.85
R5246:4932438A13Rik	UTSW	3	37048050	missense	probably damaging	1.00
R5289:4932438A13Rik	UTSW	3	37000109	missense	probably damaging	0.97
R5348:4932438A13Rik	UTSW	3	37048146	missense	probably damaging	1.00
R5394:4932438A13Rik	UTSW	3	36917668	missense	probably damaging	1.00
R5434:4932438A13Rik	UTSW	3	36875516	missense	probably damaging	1.00
R5667:4932438A13Rik	UTSW	3	36917677	missense	probably benign	0.00
R5686:4932438A13Rik	UTSW	3	36917660	missense	probably benign	0.00
R5701:4932438A13Rik	UTSW	3	36921360	missense	probably benign	0.10
R5778:4932438A13Rik	UTSW	3	36958714	missense	probably damaging	1.00
R5787:4932438A13Rik	UTSW	3	36992733	splice site	probably null
R5800:4932438A13Rik	UTSW	3	37052443	missense	probably damaging	1.00
R5819:4932438A13Rik	UTSW	3	37048600	missense	probably benign	0.12
R5820:4932438A13Rik	UTSW	3	37039526	missense	probably benign	0.00
R5952:4932438A13Rik	UTSW	3	36965621	missense	probably damaging	1.00
R5975:4932438A13Rik	UTSW	3	36969221	missense	possibly damaging	0.64
R5996:4932438A13Rik	UTSW	3	36931116	missense	probably benign	0.07
R6192:4932438A13Rik	UTSW	3	36988169	missense	probably benign	0.00
R6225:4932438A13Rik	UTSW	3	36948304	missense	probably damaging	1.00
R6234:4932438A13Rik	UTSW	3	36983471	missense	probably benign	0.00
R6244:4932438A13Rik	UTSW	3	36956999	missense	probably benign
R6263:4932438A13Rik	UTSW	3	36931111	missense	probably benign	0.06
R6351:4932438A13Rik	UTSW	3	36908228	missense	probably damaging	1.00
R6380:4932438A13Rik	UTSW	3	37033307	missense	probably benign	0.19
R6468:4932438A13Rik	UTSW	3	37008443	missense	probably damaging	1.00
R6759:4932438A13Rik	UTSW	3	36988085	missense	possibly damaging	0.81
R6792:4932438A13Rik	UTSW	3	37011566	critical splice acceptor site	probably null
R6809:4932438A13Rik	UTSW	3	36874282	missense	probably damaging	0.98
R6841:4932438A13Rik	UTSW	3	37021481	missense	probably damaging	1.00
R6959:4932438A13Rik	UTSW	3	36967189	missense	probably damaging	1.00
R7102:4932438A13Rik	UTSW	3	36940798	missense	probably damaging	0.99
R7188:4932438A13Rik	UTSW	3	36950013	missense	probably benign	0.06
R7212:4932438A13Rik	UTSW	3	37048009	missense
R7425:4932438A13Rik	UTSW	3	36948341	missense	probably benign
R7425:4932438A13Rik	UTSW	3	36983394	missense	probably benign	0.02
R7451:4932438A13Rik	UTSW	3	37022807	splice site	probably null
R7604:4932438A13Rik	UTSW	3	36949843	splice site	probably null
R7622:4932438A13Rik	UTSW	3	36948413	nonsense	probably null
R7671:4932438A13Rik	UTSW	3	36943231	missense	probably damaging	0.99
R7699:4932438A13Rik	UTSW	3	36974172	missense	possibly damaging	0.67
R7699:4932438A13Rik	UTSW	3	37026154	missense	probably benign	0.00
R7700:4932438A13Rik	UTSW	3	36974172	missense	possibly damaging	0.67
R7700:4932438A13Rik	UTSW	3	37026154	missense	probably benign	0.00
R7748:4932438A13Rik	UTSW	3	36959335	critical splice acceptor site	probably null
R7767:4932438A13Rik	UTSW	3	36920287	critical splice donor site	probably null
R7787:4932438A13Rik	UTSW	3	36885408	missense	probably damaging	1.00
R7830:4932438A13Rik	UTSW	3	36964932	frame shift	probably null
R7849:4932438A13Rik	UTSW	3	37026328	missense
R7912:4932438A13Rik	UTSW	3	37007069	missense	probably damaging	0.99
R7914:4932438A13Rik	UTSW	3	36946283	missense	probably benign	0.13
R7945:4932438A13Rik	UTSW	3	36965893	missense	probably benign	0.03
R8039:4932438A13Rik	UTSW	3	36943214	missense	probably benign	0.12
R8101:4932438A13Rik	UTSW	3	37008502	missense	probably damaging	1.00
R8143:4932438A13Rik	UTSW	3	36946508	critical splice donor site	probably null
R8145:4932438A13Rik	UTSW	3	36998267	missense	probably damaging	1.00
R8171:4932438A13Rik	UTSW	3	36975713	missense	probably benign	0.00
R8210:4932438A13Rik	UTSW	3	37012881	missense
R8250:4932438A13Rik	UTSW	3	36917662	missense	probably damaging	0.99
R8369:4932438A13Rik	UTSW	3	37011603	missense
R8478:4932438A13Rik	UTSW	3	37033277	missense	possibly damaging	0.74
R8558:4932438A13Rik	UTSW	3	37048601	missense
R8688:4932438A13Rik	UTSW	3	37035917	missense
R8724:4932438A13Rik	UTSW	3	36890893	missense	probably damaging	0.99
R8818:4932438A13Rik	UTSW	3	36996548	missense	possibly damaging	0.60
R8869:4932438A13Rik	UTSW	3	36958858	missense	probably damaging	0.99
R8887:4932438A13Rik	UTSW	3	37033354	missense	possibly damaging	0.95
R8899:4932438A13Rik	UTSW	3	36988280	missense	probably damaging	1.00
R8907:4932438A13Rik	UTSW	3	36948146	nonsense	probably null
R8960:4932438A13Rik	UTSW	3	37012983	missense	probably damaging	1.00
R8990:4932438A13Rik	UTSW	3	36921221	missense	possibly damaging	0.60
R9021:4932438A13Rik	UTSW	3	36998344	missense	probably benign	0.00
R9048:4932438A13Rik	UTSW	3	37011777	missense
R9100:4932438A13Rik	UTSW	3	37044758	missense
R9166:4932438A13Rik	UTSW	3	36987367	missense	probably damaging	1.00
R9176:4932438A13Rik	UTSW	3	36956703	missense	possibly damaging	0.82
R9202:4932438A13Rik	UTSW	3	36890821	missense	probably benign
R9303:4932438A13Rik	UTSW	3	37044820	missense
R9305:4932438A13Rik	UTSW	3	37044820	missense
R9332:4932438A13Rik	UTSW	3	37050840	missense
R9362:4932438A13Rik	UTSW	3	36957013	missense	probably benign
R9493:4932438A13Rik	UTSW	3	37011736	missense
R9534:4932438A13Rik	UTSW	3	36998270	missense	probably benign	0.01
R9593:4932438A13Rik	UTSW	3	36947941	missense	probably damaging	1.00
R9600:4932438A13Rik	UTSW	3	37041416	nonsense	probably null
R9733:4932438A13Rik	UTSW	3	37048583	missense
R9751:4932438A13Rik	UTSW	3	37011740	missense
RF013:4932438A13Rik	UTSW	3	37050757	critical splice acceptor site	probably benign
RF015:4932438A13Rik	UTSW	3	37050748	critical splice acceptor site	probably benign
RF021:4932438A13Rik	UTSW	3	37050748	critical splice acceptor site	probably benign
RF023:4932438A13Rik	UTSW	3	37050760	critical splice acceptor site	probably benign
RF034:4932438A13Rik	UTSW	3	37050760	critical splice acceptor site	probably benign
RF035:4932438A13Rik	UTSW	3	37050758	critical splice acceptor site	probably benign
RF055:4932438A13Rik	UTSW	3	37050757	critical splice acceptor site	probably benign
X0050:4932438A13Rik	UTSW	3	36957128	missense	probably damaging	1.00
Z1088:4932438A13Rik	UTSW	3	36987567	missense	probably damaging	1.00
Z1177:4932438A13Rik	UTSW	3	36919950	missense	probably benign
Z1177:4932438A13Rik	UTSW	3	36983440	missense	possibly damaging	0.88
Z1177:4932438A13Rik	UTSW	3	37036707	missense

Predicted Primers

PCR Primer
(F):5'- AGTGACTTTCAGATTTCATTCTGG -3'
(R):5'- ATGCCTCGATCAAAGAGAGC -3'

Sequencing Primer
(F):5'- GACTTTCAGATTTCATTCTGGTTTTG -3'
(R):5'- CCTCGATCAAAGAGAGCATGCAAG -3'

Posted On

2022-08-09