Incidental Mutation 'R9569:Clca3a2'
ID 721823
Institutional Source Beutler Lab
Gene Symbol Clca3a2
Ensembl Gene ENSMUSG00000028262
Gene Name chloride channel accessory 3A2
Synonyms Clca2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock # R9569 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 144796559-144819494 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 144807314 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029929] [ENSMUST00000199029]
AlphaFold Q9EQR4
Predicted Effect probably null
Transcript: ENSMUST00000029929
SMART Domains Protein: ENSMUSP00000029929
Gene: ENSMUSG00000028262

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.5e-21 SMART
FN3 758 857 5.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197013
Predicted Effect probably benign
Transcript: ENSMUST00000199029
SMART Domains Protein: ENSMUSP00000143543
Gene: ENSMUSG00000028262

DomainStartEndE-ValueType
Pfam:CLCA 1 188 6.5e-77 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik G C 4: 42,971,740 V358L probably benign Het
4932438A13Rik T C 3: 37,012,621 M211T Het
Abi2 T A 1: 60,464,604 V356D probably damaging Het
Adgrd1 T C 5: 129,179,637 V690A possibly damaging Het
Apba2 T C 7: 64,743,390 M553T possibly damaging Het
Apeh C T 9: 108,094,410 V13M unknown Het
Apol11b C T 15: 77,640,571 E5K possibly damaging Het
Apol7e C T 15: 77,717,733 T177I probably damaging Het
Bub1b T C 2: 118,638,403 I883T probably damaging Het
C9 T C 15: 6,459,581 S140P probably damaging Het
Cbfa2t2 T A 2: 154,504,565 I64N probably benign Het
Cd180 A T 13: 102,705,978 I511F possibly damaging Het
Cic T C 7: 25,272,695 V617A possibly damaging Het
D5Ertd579e T C 5: 36,602,635 T1394A probably damaging Het
Dclk1 A T 3: 55,480,431 E422D probably benign Het
Depdc5 A T 5: 32,867,977 D21V probably damaging Het
Dis3l A G 9: 64,329,547 F40S unknown Het
Duox1 T C 2: 122,318,490 V82A probably benign Het
Dus2 T C 8: 106,044,875 V211A probably damaging Het
Eif2ak4 G A 2: 118,420,835 S326N probably benign Het
Fat3 A C 9: 15,919,199 L153R Het
Gpx8 C T 13: 113,045,591 V103I probably damaging Het
Gtf2a1l A G 17: 88,694,520 D268G probably benign Het
Hc T C 2: 35,036,347 I342V probably benign Het
Hsp90ab1 T A 17: 45,568,952 D546V possibly damaging Het
Ifi206 T G 1: 173,486,643 D77A Het
Igfbp1 A G 11: 7,197,881 probably benign Het
Kdm3a T C 6: 71,607,450 D559G probably benign Het
Kif2a A G 13: 106,968,738 I565T probably benign Het
Krt2 T C 15: 101,816,489 T229A probably damaging Het
Lcmt2 G A 2: 121,140,041 A187V probably damaging Het
Mapk8ip1 A G 2: 92,387,254 M241T probably benign Het
Mup15 T C 4: 61,439,638 probably benign Het
Myo9b T C 8: 71,358,985 V1912A probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Naip5 T C 13: 100,223,313 T472A probably benign Het
Net1 A G 13: 3,888,518 F123S probably benign Het
Olfr183 A G 16: 58,999,865 Y60C probably damaging Het
Olfr335-ps T C 2: 36,301,934 Y132H probably damaging Het
Olfr666 C T 7: 104,893,318 M103I possibly damaging Het
Pcdhb13 T C 18: 37,443,100 F177S probably damaging Het
Pclo T C 5: 14,857,051 probably null Het
Perm1 A G 4: 156,218,582 T528A probably benign Het
Pik3c2a C T 7: 116,358,704 A1116T possibly damaging Het
Prox2 G A 12: 85,094,992 Q146* probably null Het
Psd A T 19: 46,320,278 C639S possibly damaging Het
Rffl T A 11: 82,812,438 T220S probably benign Het
Scn2a A G 2: 65,730,278 D1284G probably damaging Het
Scube1 T C 15: 83,629,404 Y385C probably damaging Het
Sec14l3 A T 11: 4,076,324 D388V probably damaging Het
Slc26a1 G T 5: 108,671,594 Q596K probably benign Het
Slc6a19 T C 13: 73,685,911 T343A probably benign Het
Slc7a4 A G 16: 17,575,398 V179A Het
Sox14 T G 9: 99,875,509 D49A Het
Timm22 A G 11: 76,407,370 S56G probably benign Het
Tmub2 G A 11: 102,288,327 W322* probably null Het
Tsc22d4 A G 5: 137,758,166 T8A probably benign Het
Ttn T C 2: 76,709,308 I34445V probably benign Het
Tyms A T 5: 30,063,362 Y196* probably null Het
Ube2o G A 11: 116,543,997 T546M probably damaging Het
Umodl1 A G 17: 30,998,169 Y1125C probably damaging Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Unk A T 11: 116,059,209 Q747L probably damaging Het
Vmn1r170 A G 7: 23,606,869 E232G probably benign Het
Vps41 A G 13: 18,829,226 Y338C possibly damaging Het
Washc5 T C 15: 59,344,131 M800V probably benign Het
Wt1 T A 2: 105,163,366 I348N possibly damaging Het
Xirp2 A G 2: 67,510,898 Y1161C probably damaging Het
Xpo7 A G 14: 70,668,700 M1001T possibly damaging Het
Yeats2 A T 16: 20,154,152 R19W probably damaging Het
Zfp142 T C 1: 74,576,227 T476A probably damaging Het
Zfp229 T C 17: 21,745,592 W268R possibly damaging Het
Zfp473 A G 7: 44,739,547 F50S probably damaging Het
Zfp975 A T 7: 42,661,989 M400K probably benign Het
Zkscan5 A G 5: 145,207,609 M150V probably benign Het
Znfx1 T A 2: 167,055,955 I350F Het
Other mutations in Clca3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Clca3a2 APN 3 144813627 nonsense probably null
IGL01663:Clca3a2 APN 3 144817155 missense probably damaging 0.97
IGL01779:Clca3a2 APN 3 144819378 missense possibly damaging 0.47
IGL02066:Clca3a2 APN 3 144813455 missense probably benign
IGL02301:Clca3a2 APN 3 144806372 missense probably damaging 0.98
IGL02619:Clca3a2 APN 3 144806322 missense probably damaging 1.00
IGL02852:Clca3a2 APN 3 144806343 missense probably damaging 0.98
IGL02901:Clca3a2 APN 3 144816768 missense probably damaging 1.00
IGL03162:Clca3a2 APN 3 144806416 missense probably damaging 1.00
R0032:Clca3a2 UTSW 3 144816733 missense probably benign 0.01
R0244:Clca3a2 UTSW 3 144813898 missense possibly damaging 0.90
R1249:Clca3a2 UTSW 3 144803004 missense possibly damaging 0.80
R1370:Clca3a2 UTSW 3 144813863 splice site probably benign
R1586:Clca3a2 UTSW 3 144810716 missense possibly damaging 0.94
R1776:Clca3a2 UTSW 3 144813920 missense probably damaging 1.00
R1797:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1869:Clca3a2 UTSW 3 144806403 missense probably benign 0.44
R1871:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1919:Clca3a2 UTSW 3 144810696 missense probably benign
R1923:Clca3a2 UTSW 3 144805730 missense probably damaging 1.00
R2200:Clca3a2 UTSW 3 144813924 missense probably benign 0.10
R2324:Clca3a2 UTSW 3 144806280 critical splice donor site probably null
R2937:Clca3a2 UTSW 3 144813918 missense probably benign 0.06
R3429:Clca3a2 UTSW 3 144806327 missense probably benign 0.07
R3434:Clca3a2 UTSW 3 144808761 unclassified probably benign
R3551:Clca3a2 UTSW 3 144803081 missense probably damaging 1.00
R3952:Clca3a2 UTSW 3 144803061 missense probably damaging 1.00
R4120:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4383:Clca3a2 UTSW 3 144806320 missense probably benign 0.02
R4518:Clca3a2 UTSW 3 144808705 missense probably damaging 1.00
R4598:Clca3a2 UTSW 3 144805683 missense probably damaging 1.00
R4801:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4802:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4816:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4934:Clca3a2 UTSW 3 144817931 missense probably damaging 1.00
R4942:Clca3a2 UTSW 3 144806502 missense probably damaging 1.00
R5123:Clca3a2 UTSW 3 144806343 missense probably damaging 1.00
R5156:Clca3a2 UTSW 3 144805838 missense probably benign 0.26
R5275:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R5372:Clca3a2 UTSW 3 144797525 missense probably benign 0.00
R5656:Clca3a2 UTSW 3 144797632 missense probably benign 0.26
R6059:Clca3a2 UTSW 3 144810770 missense probably damaging 1.00
R6155:Clca3a2 UTSW 3 144819357 missense probably damaging 0.99
R6254:Clca3a2 UTSW 3 144802134 missense probably benign
R6336:Clca3a2 UTSW 3 144806478 missense probably benign
R6470:Clca3a2 UTSW 3 144804263 splice site probably null
R6593:Clca3a2 UTSW 3 144808577 critical splice donor site probably null
R6631:Clca3a2 UTSW 3 144813644 missense probably benign
R6826:Clca3a2 UTSW 3 144818054 missense possibly damaging 0.46
R6836:Clca3a2 UTSW 3 144806383 missense probably damaging 0.97
R6896:Clca3a2 UTSW 3 144808701 missense probably damaging 1.00
R7211:Clca3a2 UTSW 3 144814014 missense probably benign 0.00
R7324:Clca3a2 UTSW 3 144808611 missense probably damaging 0.99
R7411:Clca3a2 UTSW 3 144802099 missense probably damaging 1.00
R7486:Clca3a2 UTSW 3 144797601 missense probably damaging 1.00
R7491:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R7521:Clca3a2 UTSW 3 144801913 makesense probably null
R7889:Clca3a2 UTSW 3 144810813 nonsense probably null
R7946:Clca3a2 UTSW 3 144807314 critical splice donor site probably null
R7991:Clca3a2 UTSW 3 144813995 missense probably benign 0.00
R8022:Clca3a2 UTSW 3 144805766 missense probably damaging 1.00
R8344:Clca3a2 UTSW 3 144805942 critical splice acceptor site probably null
R8367:Clca3a2 UTSW 3 144817747 splice site probably null
R8371:Clca3a2 UTSW 3 144807353 nonsense probably null
R8814:Clca3a2 UTSW 3 144797764 missense probably benign 0.18
R9031:Clca3a2 UTSW 3 144805714 missense probably damaging 1.00
R9201:Clca3a2 UTSW 3 144813923 missense probably benign 0.00
R9261:Clca3a2 UTSW 3 144819397 missense probably benign
R9469:Clca3a2 UTSW 3 144802177 missense probably damaging 1.00
R9515:Clca3a2 UTSW 3 144803047 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGAGGAAAAGGTAACCACATTTTG -3'
(R):5'- GTTTAGAAACTCATCTTCTGTGGAG -3'

Sequencing Primer
(F):5'- GGTAACCACATTTTGTATGACTTCTG -3'
(R):5'- GAAAGTTCACAGCCTGAGTTC -3'
Posted On 2022-08-09