Incidental Mutation 'R9569:Depdc5'
ID 721830
Institutional Source Beutler Lab
Gene Symbol Depdc5
Ensembl Gene ENSMUSG00000037426
Gene Name DEP domain containing 5
Synonyms
MMRRC Submission 068966-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9569 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 33021045-33151580 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 33025321 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 21 (D21V)
Ref Sequence ENSEMBL: ENSMUSP00000113862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000118698] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000125574] [ENSMUST00000149350] [ENSMUST00000150130] [ENSMUST00000195980] [ENSMUST00000202927]
AlphaFold P61460
Predicted Effect possibly damaging
Transcript: ENSMUST00000049780
AA Change: D21V

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426
AA Change: D21V

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-64 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000087897
AA Change: D21V

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: D21V

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 2.3e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 994 1006 N/A INTRINSIC
low complexity region 1159 1175 N/A INTRINSIC
DEP 1184 1259 2.49e-15 SMART
low complexity region 1322 1335 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118698
AA Change: D21V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112906
Gene: ENSMUSG00000037426
AA Change: D21V

DomainStartEndE-ValueType
Pfam:DUF3608 100 205 1.9e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119705
AA Change: D21V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: D21V

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3e-117 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1150 1166 N/A INTRINSIC
DEP 1175 1250 2.49e-15 SMART
low complexity region 1313 1326 N/A INTRINSIC
low complexity region 1511 1525 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120902
AA Change: D21V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: D21V

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
DEP 1153 1228 2.49e-15 SMART
low complexity region 1291 1304 N/A INTRINSIC
low complexity region 1489 1503 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125574
AA Change: D21V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122173
Gene: ENSMUSG00000037426
AA Change: D21V

DomainStartEndE-ValueType
Pfam:DUF3608 100 137 6.9e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149350
AA Change: D21V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122461
Gene: ENSMUSG00000037426
AA Change: D21V

DomainStartEndE-ValueType
Pfam:DUF3608 100 161 1.5e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150130
AA Change: D21V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000195980
AA Change: D21V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143228
Gene: ENSMUSG00000037426
AA Change: D21V

DomainStartEndE-ValueType
Pfam:DUF3608 100 147 4e-7 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi2 T A 1: 60,503,763 (GRCm39) V356D probably damaging Het
Adgrd1 T C 5: 129,256,701 (GRCm39) V690A possibly damaging Het
Apba2 T C 7: 64,393,138 (GRCm39) M553T possibly damaging Het
Apeh C T 9: 107,971,609 (GRCm39) V13M unknown Het
Apol11b C T 15: 77,524,771 (GRCm39) E5K possibly damaging Het
Apol7e C T 15: 77,601,933 (GRCm39) T177I probably damaging Het
Bltp1 T C 3: 37,066,770 (GRCm39) M211T Het
Bub1b T C 2: 118,468,884 (GRCm39) I883T probably damaging Het
C9 T C 15: 6,489,062 (GRCm39) S140P probably damaging Het
Cbfa2t2 T A 2: 154,346,485 (GRCm39) I64N probably benign Het
Cd180 A T 13: 102,842,486 (GRCm39) I511F possibly damaging Het
Cic T C 7: 24,972,120 (GRCm39) V617A possibly damaging Het
Clca3a2 A C 3: 144,513,075 (GRCm39) probably null Het
D5Ertd579e T C 5: 36,759,979 (GRCm39) T1394A probably damaging Het
Dclk1 A T 3: 55,387,852 (GRCm39) E422D probably benign Het
Dis3l A G 9: 64,236,829 (GRCm39) F40S unknown Het
Duox1 T C 2: 122,148,971 (GRCm39) V82A probably benign Het
Dus2 T C 8: 106,771,507 (GRCm39) V211A probably damaging Het
Eif2ak4 G A 2: 118,251,316 (GRCm39) S326N probably benign Het
Fat3 A C 9: 15,830,495 (GRCm39) L153R Het
Gpx8 C T 13: 113,182,125 (GRCm39) V103I probably damaging Het
Gtf2a1l A G 17: 89,001,948 (GRCm39) D268G probably benign Het
Hc T C 2: 34,926,359 (GRCm39) I342V probably benign Het
Hsp90ab1 T A 17: 45,879,878 (GRCm39) D546V possibly damaging Het
Ifi206 T G 1: 173,314,209 (GRCm39) D77A Het
Igfbp1 A G 11: 7,147,881 (GRCm39) probably benign Het
Kdm3a T C 6: 71,584,434 (GRCm39) D559G probably benign Het
Kif2a A G 13: 107,105,246 (GRCm39) I565T probably benign Het
Krt1c T C 15: 101,724,924 (GRCm39) T229A probably damaging Het
Lcmt2 G A 2: 120,970,522 (GRCm39) A187V probably damaging Het
Mapk8ip1 A G 2: 92,217,599 (GRCm39) M241T probably benign Het
Mup15 T C 4: 61,357,875 (GRCm39) probably benign Het
Myo9b T C 8: 71,811,629 (GRCm39) V1912A probably benign Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Naip5 T C 13: 100,359,821 (GRCm39) T472A probably benign Het
Net1 A G 13: 3,938,518 (GRCm39) F123S probably benign Het
Or1j8 T C 2: 36,191,946 (GRCm39) Y132H probably damaging Het
Or52n2 C T 7: 104,542,525 (GRCm39) M103I possibly damaging Het
Or5h17 A G 16: 58,820,228 (GRCm39) Y60C probably damaging Het
Pcdhb13 T C 18: 37,576,153 (GRCm39) F177S probably damaging Het
Pclo T C 5: 14,907,065 (GRCm39) probably null Het
Perm1 A G 4: 156,303,039 (GRCm39) T528A probably benign Het
Pik3c2a C T 7: 115,957,939 (GRCm39) A1116T possibly damaging Het
Prox2 G A 12: 85,141,766 (GRCm39) Q146* probably null Het
Psd A T 19: 46,308,717 (GRCm39) C639S possibly damaging Het
Rffl T A 11: 82,703,264 (GRCm39) T220S probably benign Het
Scn2a A G 2: 65,560,622 (GRCm39) D1284G probably damaging Het
Scube1 T C 15: 83,513,605 (GRCm39) Y385C probably damaging Het
Sec14l3 A T 11: 4,026,324 (GRCm39) D388V probably damaging Het
Slc26a1 G T 5: 108,819,460 (GRCm39) Q596K probably benign Het
Slc6a19 T C 13: 73,834,030 (GRCm39) T343A probably benign Het
Slc7a4 A G 16: 17,393,262 (GRCm39) V179A Het
Sox14 T G 9: 99,757,562 (GRCm39) D49A Het
Spata31g1 G C 4: 42,971,740 (GRCm39) V358L probably benign Het
Timm22 A G 11: 76,298,196 (GRCm39) S56G probably benign Het
Tmub2 G A 11: 102,179,153 (GRCm39) W322* probably null Het
Tsc22d4 A G 5: 137,756,428 (GRCm39) T8A probably benign Het
Ttn T C 2: 76,539,652 (GRCm39) I34445V probably benign Het
Tyms A T 5: 30,268,360 (GRCm39) Y196* probably null Het
Ube2o G A 11: 116,434,823 (GRCm39) T546M probably damaging Het
Umodl1 A G 17: 31,217,143 (GRCm39) Y1125C probably damaging Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 (GRCm39) probably benign Het
Unk A T 11: 115,950,035 (GRCm39) Q747L probably damaging Het
Vmn1r170 A G 7: 23,306,294 (GRCm39) E232G probably benign Het
Vps41 A G 13: 19,013,396 (GRCm39) Y338C possibly damaging Het
Washc5 T C 15: 59,215,980 (GRCm39) M800V probably benign Het
Wt1 T A 2: 104,993,711 (GRCm39) I348N possibly damaging Het
Xirp2 A G 2: 67,341,242 (GRCm39) Y1161C probably damaging Het
Xpo7 A G 14: 70,906,140 (GRCm39) M1001T possibly damaging Het
Yeats2 A T 16: 19,972,902 (GRCm39) R19W probably damaging Het
Zfp142 T C 1: 74,615,386 (GRCm39) T476A probably damaging Het
Zfp229 T C 17: 21,964,573 (GRCm39) W268R possibly damaging Het
Zfp473 A G 7: 44,388,971 (GRCm39) F50S probably damaging Het
Zfp975 A T 7: 42,311,413 (GRCm39) M400K probably benign Het
Zkscan5 A G 5: 145,144,419 (GRCm39) M150V probably benign Het
Znfx1 T A 2: 166,897,875 (GRCm39) I350F Het
Other mutations in Depdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Depdc5 APN 5 33,125,158 (GRCm39) splice site probably null
IGL01019:Depdc5 APN 5 33,050,745 (GRCm39) missense probably damaging 0.96
IGL01067:Depdc5 APN 5 33,056,411 (GRCm39) splice site probably null
IGL01405:Depdc5 APN 5 33,095,033 (GRCm39) missense possibly damaging 0.90
IGL01577:Depdc5 APN 5 33,113,241 (GRCm39) missense possibly damaging 0.49
IGL01633:Depdc5 APN 5 33,081,544 (GRCm39) missense probably damaging 1.00
IGL01998:Depdc5 APN 5 33,102,495 (GRCm39) splice site probably benign
IGL02025:Depdc5 APN 5 33,103,976 (GRCm39) critical splice acceptor site probably null
IGL02167:Depdc5 APN 5 33,061,145 (GRCm39) missense probably damaging 1.00
IGL02537:Depdc5 APN 5 33,125,131 (GRCm39) missense probably damaging 1.00
IGL02812:Depdc5 APN 5 33,050,712 (GRCm39) splice site probably benign
IGL03001:Depdc5 APN 5 33,102,434 (GRCm39) missense possibly damaging 0.74
IGL03253:Depdc5 APN 5 33,026,157 (GRCm39) unclassified probably benign
alligator UTSW 5 33,121,851 (GRCm39) splice site probably null
lagarto UTSW 5 33,136,852 (GRCm39) missense probably damaging 1.00
sauros UTSW 5 33,144,310 (GRCm39) missense possibly damaging 0.92
IGL02988:Depdc5 UTSW 5 33,113,511 (GRCm39) splice site probably null
R0038:Depdc5 UTSW 5 33,026,197 (GRCm39) missense probably benign 0.01
R0038:Depdc5 UTSW 5 33,026,197 (GRCm39) missense probably benign 0.01
R0153:Depdc5 UTSW 5 33,091,281 (GRCm39) splice site probably benign
R0179:Depdc5 UTSW 5 33,058,918 (GRCm39) unclassified probably benign
R0212:Depdc5 UTSW 5 33,069,586 (GRCm39) missense probably benign 0.00
R0239:Depdc5 UTSW 5 33,100,584 (GRCm39) missense probably damaging 1.00
R0239:Depdc5 UTSW 5 33,100,584 (GRCm39) missense probably damaging 1.00
R0302:Depdc5 UTSW 5 33,061,890 (GRCm39) critical splice donor site probably benign
R0511:Depdc5 UTSW 5 33,102,372 (GRCm39) nonsense probably null
R0677:Depdc5 UTSW 5 33,058,814 (GRCm39) missense probably damaging 1.00
R0884:Depdc5 UTSW 5 33,075,322 (GRCm39) missense possibly damaging 0.94
R0973:Depdc5 UTSW 5 33,144,310 (GRCm39) missense possibly damaging 0.92
R1314:Depdc5 UTSW 5 33,034,418 (GRCm39) missense probably damaging 1.00
R1611:Depdc5 UTSW 5 33,148,297 (GRCm39) missense probably damaging 1.00
R1687:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R1748:Depdc5 UTSW 5 33,075,286 (GRCm39) missense probably benign 0.24
R1903:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R1956:Depdc5 UTSW 5 33,061,175 (GRCm39) missense probably damaging 1.00
R1997:Depdc5 UTSW 5 33,059,250 (GRCm39) critical splice donor site probably null
R2079:Depdc5 UTSW 5 33,104,018 (GRCm39) missense possibly damaging 0.75
R2131:Depdc5 UTSW 5 33,148,125 (GRCm39) nonsense probably null
R2291:Depdc5 UTSW 5 33,136,746 (GRCm39) missense probably damaging 1.00
R2422:Depdc5 UTSW 5 33,148,379 (GRCm39) missense probably damaging 1.00
R2851:Depdc5 UTSW 5 33,081,515 (GRCm39) missense probably damaging 0.96
R2852:Depdc5 UTSW 5 33,081,515 (GRCm39) missense probably damaging 0.96
R2937:Depdc5 UTSW 5 33,058,965 (GRCm39) splice site probably null
R2938:Depdc5 UTSW 5 33,058,965 (GRCm39) splice site probably null
R2974:Depdc5 UTSW 5 33,091,361 (GRCm39) critical splice donor site probably null
R3884:Depdc5 UTSW 5 33,101,421 (GRCm39) missense probably damaging 1.00
R3967:Depdc5 UTSW 5 33,101,459 (GRCm39) nonsense probably null
R4118:Depdc5 UTSW 5 33,121,979 (GRCm39) missense probably damaging 1.00
R4197:Depdc5 UTSW 5 33,148,547 (GRCm39) missense possibly damaging 0.93
R4407:Depdc5 UTSW 5 33,061,878 (GRCm39) critical splice donor site probably null
R4534:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R4535:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R4538:Depdc5 UTSW 5 33,141,290 (GRCm39) missense probably damaging 1.00
R4613:Depdc5 UTSW 5 33,132,790 (GRCm39) missense probably damaging 1.00
R4736:Depdc5 UTSW 5 33,132,666 (GRCm39) missense probably benign
R4738:Depdc5 UTSW 5 33,132,666 (GRCm39) missense probably benign
R4765:Depdc5 UTSW 5 33,094,979 (GRCm39) missense probably damaging 1.00
R5021:Depdc5 UTSW 5 33,136,758 (GRCm39) missense probably damaging 1.00
R5259:Depdc5 UTSW 5 33,095,635 (GRCm39) missense probably damaging 1.00
R5261:Depdc5 UTSW 5 33,095,635 (GRCm39) missense probably damaging 1.00
R5541:Depdc5 UTSW 5 33,021,973 (GRCm39) utr 5 prime probably benign
R5594:Depdc5 UTSW 5 33,058,834 (GRCm39) missense possibly damaging 0.46
R5929:Depdc5 UTSW 5 33,132,850 (GRCm39) nonsense probably null
R6132:Depdc5 UTSW 5 33,067,811 (GRCm39) missense probably damaging 0.99
R6146:Depdc5 UTSW 5 33,126,075 (GRCm39) missense probably benign 0.01
R6336:Depdc5 UTSW 5 33,121,851 (GRCm39) splice site probably null
R6468:Depdc5 UTSW 5 33,069,575 (GRCm39) missense probably benign 0.02
R6911:Depdc5 UTSW 5 33,081,536 (GRCm39) missense probably damaging 1.00
R6969:Depdc5 UTSW 5 33,141,204 (GRCm39) missense probably damaging 1.00
R7002:Depdc5 UTSW 5 33,034,502 (GRCm39) splice site probably null
R7066:Depdc5 UTSW 5 33,059,192 (GRCm39) missense probably benign 0.08
R7231:Depdc5 UTSW 5 33,059,209 (GRCm39) missense possibly damaging 0.92
R7264:Depdc5 UTSW 5 33,125,089 (GRCm39) missense probably benign
R7302:Depdc5 UTSW 5 33,136,852 (GRCm39) missense probably damaging 1.00
R7386:Depdc5 UTSW 5 33,085,280 (GRCm39) missense probably benign
R7564:Depdc5 UTSW 5 33,058,854 (GRCm39) missense probably damaging 1.00
R7636:Depdc5 UTSW 5 33,075,327 (GRCm39) missense probably benign
R7795:Depdc5 UTSW 5 33,101,447 (GRCm39) missense probably damaging 1.00
R7845:Depdc5 UTSW 5 33,061,259 (GRCm39) splice site probably null
R8013:Depdc5 UTSW 5 33,131,186 (GRCm39) missense probably benign 0.01
R8037:Depdc5 UTSW 5 33,116,692 (GRCm39) critical splice donor site probably null
R8038:Depdc5 UTSW 5 33,116,692 (GRCm39) critical splice donor site probably null
R8065:Depdc5 UTSW 5 33,053,252 (GRCm39) missense possibly damaging 0.89
R8067:Depdc5 UTSW 5 33,053,252 (GRCm39) missense possibly damaging 0.89
R8108:Depdc5 UTSW 5 33,102,393 (GRCm39) missense probably benign 0.01
R8112:Depdc5 UTSW 5 33,126,050 (GRCm39) missense possibly damaging 0.67
R8213:Depdc5 UTSW 5 33,094,981 (GRCm39) missense probably damaging 1.00
R8382:Depdc5 UTSW 5 33,085,242 (GRCm39) missense probably benign 0.00
R8680:Depdc5 UTSW 5 33,101,382 (GRCm39) missense possibly damaging 0.48
R8743:Depdc5 UTSW 5 33,081,587 (GRCm39) missense probably benign 0.10
R8754:Depdc5 UTSW 5 33,136,881 (GRCm39) missense probably benign 0.00
R9157:Depdc5 UTSW 5 33,102,452 (GRCm39) missense probably damaging 0.98
R9364:Depdc5 UTSW 5 33,122,076 (GRCm39) missense probably benign
R9441:Depdc5 UTSW 5 33,095,042 (GRCm39) missense probably benign 0.03
R9450:Depdc5 UTSW 5 33,091,354 (GRCm39) missense probably benign
R9459:Depdc5 UTSW 5 33,148,117 (GRCm39) missense probably damaging 0.99
R9554:Depdc5 UTSW 5 33,122,076 (GRCm39) missense probably benign
R9647:Depdc5 UTSW 5 33,081,567 (GRCm39) missense possibly damaging 0.94
R9688:Depdc5 UTSW 5 33,055,276 (GRCm39) nonsense probably null
X0027:Depdc5 UTSW 5 33,061,636 (GRCm39) missense probably damaging 1.00
Z1176:Depdc5 UTSW 5 33,100,626 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GAGACACCTATGTTAGTCAAGAAAG -3'
(R):5'- GGGTCTTACTACACAGCTCTGAC -3'

Sequencing Primer
(F):5'- TAATACCAACATGATGGGGTGCCC -3'
(R):5'- CAGCTCTGACTAGCCTGAAGTAG -3'
Posted On 2022-08-09