Incidental Mutation 'R9569:Adgrd1'
ID 721833
Institutional Source Beutler Lab
Gene Symbol Adgrd1
Ensembl Gene ENSMUSG00000044017
Gene Name adhesion G protein-coupled receptor D1
Synonyms E230012M21Rik, Gpr133
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9569 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 129096750-129204599 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 129179637 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 690 (V690A)
Ref Sequence ENSEMBL: ENSMUSP00000060307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056617] [ENSMUST00000156437]
AlphaFold Q80T32
Predicted Effect possibly damaging
Transcript: ENSMUST00000056617
AA Change: V690A

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000060307
Gene: ENSMUSG00000044017
AA Change: V690A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Laminin_G_3 119 273 2.9e-18 PFAM
Pfam:Pentaxin 171 288 2.2e-7 PFAM
GPS 535 585 1.57e-14 SMART
Pfam:Dicty_CAR 590 856 1.2e-8 PFAM
Pfam:7tm_2 592 831 8e-58 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000156437
AA Change: V658A

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121217
Gene: ENSMUSG00000044017
AA Change: V658A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The adhesion G-protein-coupled receptors (GPCRs), including GPR133, are membrane-bound proteins with long N termini containing multiple domains. GPCRs, or GPRs, contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins (summary by Bjarnadottir et al., 2004 [PubMed 15203201]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik G C 4: 42,971,740 V358L probably benign Het
4932438A13Rik T C 3: 37,012,621 M211T Het
Abi2 T A 1: 60,464,604 V356D probably damaging Het
Apba2 T C 7: 64,743,390 M553T possibly damaging Het
Apeh C T 9: 108,094,410 V13M unknown Het
Apol11b C T 15: 77,640,571 E5K possibly damaging Het
Apol7e C T 15: 77,717,733 T177I probably damaging Het
Bub1b T C 2: 118,638,403 I883T probably damaging Het
C9 T C 15: 6,459,581 S140P probably damaging Het
Cbfa2t2 T A 2: 154,504,565 I64N probably benign Het
Cd180 A T 13: 102,705,978 I511F possibly damaging Het
Cic T C 7: 25,272,695 V617A possibly damaging Het
Clca3a2 A C 3: 144,807,314 probably null Het
D5Ertd579e T C 5: 36,602,635 T1394A probably damaging Het
Dclk1 A T 3: 55,480,431 E422D probably benign Het
Depdc5 A T 5: 32,867,977 D21V probably damaging Het
Dis3l A G 9: 64,329,547 F40S unknown Het
Duox1 T C 2: 122,318,490 V82A probably benign Het
Dus2 T C 8: 106,044,875 V211A probably damaging Het
Eif2ak4 G A 2: 118,420,835 S326N probably benign Het
Fat3 A C 9: 15,919,199 L153R Het
Gpx8 C T 13: 113,045,591 V103I probably damaging Het
Gtf2a1l A G 17: 88,694,520 D268G probably benign Het
Hc T C 2: 35,036,347 I342V probably benign Het
Hsp90ab1 T A 17: 45,568,952 D546V possibly damaging Het
Ifi206 T G 1: 173,486,643 D77A Het
Igfbp1 A G 11: 7,197,881 probably benign Het
Kdm3a T C 6: 71,607,450 D559G probably benign Het
Kif2a A G 13: 106,968,738 I565T probably benign Het
Krt2 T C 15: 101,816,489 T229A probably damaging Het
Lcmt2 G A 2: 121,140,041 A187V probably damaging Het
Mapk8ip1 A G 2: 92,387,254 M241T probably benign Het
Mup15 T C 4: 61,439,638 probably benign Het
Myo9b T C 8: 71,358,985 V1912A probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Naip5 T C 13: 100,223,313 T472A probably benign Het
Net1 A G 13: 3,888,518 F123S probably benign Het
Olfr183 A G 16: 58,999,865 Y60C probably damaging Het
Olfr335-ps T C 2: 36,301,934 Y132H probably damaging Het
Olfr666 C T 7: 104,893,318 M103I possibly damaging Het
Pcdhb13 T C 18: 37,443,100 F177S probably damaging Het
Pclo T C 5: 14,857,051 probably null Het
Perm1 A G 4: 156,218,582 T528A probably benign Het
Pik3c2a C T 7: 116,358,704 A1116T possibly damaging Het
Prox2 G A 12: 85,094,992 Q146* probably null Het
Psd A T 19: 46,320,278 C639S possibly damaging Het
Rffl T A 11: 82,812,438 T220S probably benign Het
Scn2a A G 2: 65,730,278 D1284G probably damaging Het
Scube1 T C 15: 83,629,404 Y385C probably damaging Het
Sec14l3 A T 11: 4,076,324 D388V probably damaging Het
Slc26a1 G T 5: 108,671,594 Q596K probably benign Het
Slc6a19 T C 13: 73,685,911 T343A probably benign Het
Slc7a4 A G 16: 17,575,398 V179A Het
Sox14 T G 9: 99,875,509 D49A Het
Timm22 A G 11: 76,407,370 S56G probably benign Het
Tmub2 G A 11: 102,288,327 W322* probably null Het
Tsc22d4 A G 5: 137,758,166 T8A probably benign Het
Ttn T C 2: 76,709,308 I34445V probably benign Het
Tyms A T 5: 30,063,362 Y196* probably null Het
Ube2o G A 11: 116,543,997 T546M probably damaging Het
Umodl1 A G 17: 30,998,169 Y1125C probably damaging Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Unk A T 11: 116,059,209 Q747L probably damaging Het
Vmn1r170 A G 7: 23,606,869 E232G probably benign Het
Vps41 A G 13: 18,829,226 Y338C possibly damaging Het
Washc5 T C 15: 59,344,131 M800V probably benign Het
Wt1 T A 2: 105,163,366 I348N possibly damaging Het
Xirp2 A G 2: 67,510,898 Y1161C probably damaging Het
Xpo7 A G 14: 70,668,700 M1001T possibly damaging Het
Yeats2 A T 16: 20,154,152 R19W probably damaging Het
Zfp142 T C 1: 74,576,227 T476A probably damaging Het
Zfp229 T C 17: 21,745,592 W268R possibly damaging Het
Zfp473 A G 7: 44,739,547 F50S probably damaging Het
Zfp975 A T 7: 42,661,989 M400K probably benign Het
Zkscan5 A G 5: 145,207,609 M150V probably benign Het
Znfx1 T A 2: 167,055,955 I350F Het
Other mutations in Adgrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Adgrd1 APN 5 129139592 missense probably benign 0.06
IGL01384:Adgrd1 APN 5 129097209 missense possibly damaging 0.47
IGL01636:Adgrd1 APN 5 129142452 splice site probably benign
IGL01916:Adgrd1 APN 5 129132838 missense probably benign 0.12
IGL01923:Adgrd1 APN 5 129178079 missense possibly damaging 0.58
IGL02019:Adgrd1 APN 5 129115138 missense probably benign 0.00
IGL02142:Adgrd1 APN 5 129131584 missense probably benign
IGL02149:Adgrd1 APN 5 129179261 missense probably damaging 1.00
IGL02190:Adgrd1 APN 5 129140724 splice site probably benign
IGL02623:Adgrd1 APN 5 129132745 missense probably damaging 0.99
IGL02696:Adgrd1 APN 5 129140854 splice site probably benign
IGL02850:Adgrd1 APN 5 129115055 missense probably damaging 1.00
IGL02976:Adgrd1 APN 5 129131597 missense probably benign 0.00
IGL02988:Adgrd1 UTSW 5 129144010 missense probably benign 0.00
PIT4458001:Adgrd1 UTSW 5 129131577 missense probably damaging 1.00
R0081:Adgrd1 UTSW 5 129178082 missense probably damaging 0.99
R0266:Adgrd1 UTSW 5 129139594 missense probably benign 0.00
R0267:Adgrd1 UTSW 5 129139594 missense probably benign 0.00
R0464:Adgrd1 UTSW 5 129162650 missense probably damaging 1.00
R0625:Adgrd1 UTSW 5 129171931 critical splice donor site probably null
R1288:Adgrd1 UTSW 5 129129007 missense probably damaging 0.97
R1460:Adgrd1 UTSW 5 129122563 missense possibly damaging 0.63
R1635:Adgrd1 UTSW 5 129128907 missense probably damaging 1.00
R1658:Adgrd1 UTSW 5 129178100 missense probably benign 0.02
R1709:Adgrd1 UTSW 5 129179228 missense possibly damaging 0.95
R1897:Adgrd1 UTSW 5 129129001 missense probably benign 0.01
R1976:Adgrd1 UTSW 5 129140797 missense probably benign 0.06
R2049:Adgrd1 UTSW 5 129115095 missense probably benign 0.01
R2259:Adgrd1 UTSW 5 129112311 missense possibly damaging 0.92
R2295:Adgrd1 UTSW 5 129122506 missense probably benign 0.13
R3076:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R3077:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R3078:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R4581:Adgrd1 UTSW 5 129202531 missense possibly damaging 0.68
R5024:Adgrd1 UTSW 5 129171895 missense probably damaging 1.00
R5076:Adgrd1 UTSW 5 129143989 nonsense probably null
R5227:Adgrd1 UTSW 5 129122583 missense probably benign 0.00
R5453:Adgrd1 UTSW 5 129179583 missense probably damaging 0.99
R6349:Adgrd1 UTSW 5 129142539 splice site probably null
R6953:Adgrd1 UTSW 5 129115078 nonsense probably null
R7300:Adgrd1 UTSW 5 129097347 critical splice donor site probably null
R7583:Adgrd1 UTSW 5 129179588 missense probably benign 0.42
R7622:Adgrd1 UTSW 5 129139624 missense probably benign 0.27
R8205:Adgrd1 UTSW 5 129115111 missense possibly damaging 0.94
R8716:Adgrd1 UTSW 5 129188371 missense possibly damaging 0.94
R8780:Adgrd1 UTSW 5 129097074 start gained probably benign
R8850:Adgrd1 UTSW 5 129142510 missense probably benign 0.00
R9528:Adgrd1 UTSW 5 129179676 missense probably benign 0.44
R9626:Adgrd1 UTSW 5 129198657 missense probably damaging 1.00
X0067:Adgrd1 UTSW 5 129188352 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGAAACTGAGCCTTGCCTCC -3'
(R):5'- AGAACCCATTCCATTCCATCTG -3'

Sequencing Primer
(F):5'- TCCCCAGGAATAAAATGAGGTCCTG -3'
(R):5'- TGCCCCATCCCTACCCG -3'
Posted On 2022-08-09