Incidental Mutation 'R9569:Myo9b'
ID 721844
Institutional Source Beutler Lab
Gene Symbol Myo9b
Ensembl Gene ENSMUSG00000004677
Gene Name myosin IXb
Synonyms
MMRRC Submission 068966-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.852) question?
Stock # R9569 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 71725358-71813357 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71811629 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1912 (V1912A)
Ref Sequence ENSEMBL: ENSMUSP00000129220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071935] [ENSMUST00000168839] [ENSMUST00000170242] [ENSMUST00000212935]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000071935
AA Change: V1882A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071827
Gene: ENSMUSG00000004677
AA Change: V1882A

DomainStartEndE-ValueType
RA 15 114 3.7e-30 SMART
MYSc 140 954 N/A SMART
IQ 955 977 1.2e-3 SMART
IQ 978 1000 1.6e-5 SMART
IQ 1001 1022 4.3e-5 SMART
IQ 1023 1045 8.4e-5 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1232 1246 N/A INTRINSIC
Blast:MYSc 1247 1323 3e-19 BLAST
low complexity region 1348 1359 N/A INTRINSIC
coiled coil region 1563 1590 N/A INTRINSIC
C1 1591 1639 1.7e-14 SMART
RhoGAP 1668 1843 4.7e-71 SMART
coiled coil region 1901 1925 N/A INTRINSIC
low complexity region 1940 1952 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000131635
Gene: ENSMUSG00000004677
AA Change: V1896A

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1915 1939 N/A INTRINSIC
low complexity region 1954 1966 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170242
AA Change: V1912A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129220
Gene: ENSMUSG00000004677
AA Change: V1912A

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1931 1955 N/A INTRINSIC
low complexity region 1970 1982 N/A INTRINSIC
low complexity region 1992 2003 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000212935
AA Change: V1884A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin family of actin-based molecular motor heavy chain proteins. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). The protein has four IQ motifs located in the neck domain that bind calmodulin, which serves as a light chain. The protein complex has a single-headed structure and exhibits processive movement on actin filaments toward the minus-end. The protein also has rho-GTPase activity. Polymorphisms in this gene are associated with celiac disease and ulcerative colitis susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutants breed normal, but shows defect in macrophage motility and chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi2 T A 1: 60,503,763 (GRCm39) V356D probably damaging Het
Adgrd1 T C 5: 129,256,701 (GRCm39) V690A possibly damaging Het
Apba2 T C 7: 64,393,138 (GRCm39) M553T possibly damaging Het
Apeh C T 9: 107,971,609 (GRCm39) V13M unknown Het
Apol11b C T 15: 77,524,771 (GRCm39) E5K possibly damaging Het
Apol7e C T 15: 77,601,933 (GRCm39) T177I probably damaging Het
Bltp1 T C 3: 37,066,770 (GRCm39) M211T Het
Bub1b T C 2: 118,468,884 (GRCm39) I883T probably damaging Het
C9 T C 15: 6,489,062 (GRCm39) S140P probably damaging Het
Cbfa2t2 T A 2: 154,346,485 (GRCm39) I64N probably benign Het
Cd180 A T 13: 102,842,486 (GRCm39) I511F possibly damaging Het
Cic T C 7: 24,972,120 (GRCm39) V617A possibly damaging Het
Clca3a2 A C 3: 144,513,075 (GRCm39) probably null Het
D5Ertd579e T C 5: 36,759,979 (GRCm39) T1394A probably damaging Het
Dclk1 A T 3: 55,387,852 (GRCm39) E422D probably benign Het
Depdc5 A T 5: 33,025,321 (GRCm39) D21V probably damaging Het
Dis3l A G 9: 64,236,829 (GRCm39) F40S unknown Het
Duox1 T C 2: 122,148,971 (GRCm39) V82A probably benign Het
Dus2 T C 8: 106,771,507 (GRCm39) V211A probably damaging Het
Eif2ak4 G A 2: 118,251,316 (GRCm39) S326N probably benign Het
Fat3 A C 9: 15,830,495 (GRCm39) L153R Het
Gpx8 C T 13: 113,182,125 (GRCm39) V103I probably damaging Het
Gtf2a1l A G 17: 89,001,948 (GRCm39) D268G probably benign Het
Hc T C 2: 34,926,359 (GRCm39) I342V probably benign Het
Hsp90ab1 T A 17: 45,879,878 (GRCm39) D546V possibly damaging Het
Ifi206 T G 1: 173,314,209 (GRCm39) D77A Het
Igfbp1 A G 11: 7,147,881 (GRCm39) probably benign Het
Kdm3a T C 6: 71,584,434 (GRCm39) D559G probably benign Het
Kif2a A G 13: 107,105,246 (GRCm39) I565T probably benign Het
Krt1c T C 15: 101,724,924 (GRCm39) T229A probably damaging Het
Lcmt2 G A 2: 120,970,522 (GRCm39) A187V probably damaging Het
Mapk8ip1 A G 2: 92,217,599 (GRCm39) M241T probably benign Het
Mup15 T C 4: 61,357,875 (GRCm39) probably benign Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Naip5 T C 13: 100,359,821 (GRCm39) T472A probably benign Het
Net1 A G 13: 3,938,518 (GRCm39) F123S probably benign Het
Or1j8 T C 2: 36,191,946 (GRCm39) Y132H probably damaging Het
Or52n2 C T 7: 104,542,525 (GRCm39) M103I possibly damaging Het
Or5h17 A G 16: 58,820,228 (GRCm39) Y60C probably damaging Het
Pcdhb13 T C 18: 37,576,153 (GRCm39) F177S probably damaging Het
Pclo T C 5: 14,907,065 (GRCm39) probably null Het
Perm1 A G 4: 156,303,039 (GRCm39) T528A probably benign Het
Pik3c2a C T 7: 115,957,939 (GRCm39) A1116T possibly damaging Het
Prox2 G A 12: 85,141,766 (GRCm39) Q146* probably null Het
Psd A T 19: 46,308,717 (GRCm39) C639S possibly damaging Het
Rffl T A 11: 82,703,264 (GRCm39) T220S probably benign Het
Scn2a A G 2: 65,560,622 (GRCm39) D1284G probably damaging Het
Scube1 T C 15: 83,513,605 (GRCm39) Y385C probably damaging Het
Sec14l3 A T 11: 4,026,324 (GRCm39) D388V probably damaging Het
Slc26a1 G T 5: 108,819,460 (GRCm39) Q596K probably benign Het
Slc6a19 T C 13: 73,834,030 (GRCm39) T343A probably benign Het
Slc7a4 A G 16: 17,393,262 (GRCm39) V179A Het
Sox14 T G 9: 99,757,562 (GRCm39) D49A Het
Spata31g1 G C 4: 42,971,740 (GRCm39) V358L probably benign Het
Timm22 A G 11: 76,298,196 (GRCm39) S56G probably benign Het
Tmub2 G A 11: 102,179,153 (GRCm39) W322* probably null Het
Tsc22d4 A G 5: 137,756,428 (GRCm39) T8A probably benign Het
Ttn T C 2: 76,539,652 (GRCm39) I34445V probably benign Het
Tyms A T 5: 30,268,360 (GRCm39) Y196* probably null Het
Ube2o G A 11: 116,434,823 (GRCm39) T546M probably damaging Het
Umodl1 A G 17: 31,217,143 (GRCm39) Y1125C probably damaging Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 (GRCm39) probably benign Het
Unk A T 11: 115,950,035 (GRCm39) Q747L probably damaging Het
Vmn1r170 A G 7: 23,306,294 (GRCm39) E232G probably benign Het
Vps41 A G 13: 19,013,396 (GRCm39) Y338C possibly damaging Het
Washc5 T C 15: 59,215,980 (GRCm39) M800V probably benign Het
Wt1 T A 2: 104,993,711 (GRCm39) I348N possibly damaging Het
Xirp2 A G 2: 67,341,242 (GRCm39) Y1161C probably damaging Het
Xpo7 A G 14: 70,906,140 (GRCm39) M1001T possibly damaging Het
Yeats2 A T 16: 19,972,902 (GRCm39) R19W probably damaging Het
Zfp142 T C 1: 74,615,386 (GRCm39) T476A probably damaging Het
Zfp229 T C 17: 21,964,573 (GRCm39) W268R possibly damaging Het
Zfp473 A G 7: 44,388,971 (GRCm39) F50S probably damaging Het
Zfp975 A T 7: 42,311,413 (GRCm39) M400K probably benign Het
Zkscan5 A G 5: 145,144,419 (GRCm39) M150V probably benign Het
Znfx1 T A 2: 166,897,875 (GRCm39) I350F Het
Other mutations in Myo9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Myo9b APN 8 71,801,379 (GRCm39) missense probably benign
IGL01020:Myo9b APN 8 71,804,644 (GRCm39) missense probably benign
IGL01479:Myo9b APN 8 71,811,986 (GRCm39) missense probably damaging 1.00
IGL01704:Myo9b APN 8 71,812,286 (GRCm39) missense probably damaging 0.98
IGL01761:Myo9b APN 8 71,801,796 (GRCm39) missense probably damaging 0.96
IGL01766:Myo9b APN 8 71,743,161 (GRCm39) missense probably damaging 1.00
IGL01834:Myo9b APN 8 71,807,901 (GRCm39) missense possibly damaging 0.93
IGL01834:Myo9b APN 8 71,808,962 (GRCm39) missense probably damaging 1.00
IGL01838:Myo9b APN 8 71,787,034 (GRCm39) missense probably damaging 0.99
IGL02318:Myo9b APN 8 71,806,768 (GRCm39) missense probably damaging 0.98
IGL02333:Myo9b APN 8 71,811,637 (GRCm39) missense possibly damaging 0.65
IGL02340:Myo9b APN 8 71,743,689 (GRCm39) missense probably damaging 1.00
IGL02514:Myo9b APN 8 71,743,650 (GRCm39) missense probably damaging 1.00
IGL02593:Myo9b APN 8 71,743,417 (GRCm39) missense probably damaging 1.00
IGL03075:Myo9b APN 8 71,807,171 (GRCm39) missense probably damaging 1.00
IGL03332:Myo9b APN 8 71,801,418 (GRCm39) missense possibly damaging 0.78
avantgarde UTSW 8 71,796,806 (GRCm39) missense probably damaging 1.00
Freaky UTSW 8 71,743,463 (GRCm39) missense probably damaging 1.00
iconoclastic UTSW 8 71,743,119 (GRCm39) missense probably benign 0.37
unconventional UTSW 8 71,801,241 (GRCm39) missense probably benign 0.00
PIT4418001:Myo9b UTSW 8 71,775,591 (GRCm39) missense probably damaging 1.00
PIT4651001:Myo9b UTSW 8 71,795,456 (GRCm39) missense possibly damaging 0.83
R0023:Myo9b UTSW 8 71,786,412 (GRCm39) missense probably damaging 1.00
R0103:Myo9b UTSW 8 71,776,493 (GRCm39) splice site probably benign
R0103:Myo9b UTSW 8 71,776,493 (GRCm39) splice site probably benign
R0144:Myo9b UTSW 8 71,798,687 (GRCm39) missense probably damaging 1.00
R0207:Myo9b UTSW 8 71,807,869 (GRCm39) splice site probably benign
R0226:Myo9b UTSW 8 71,806,476 (GRCm39) missense probably damaging 1.00
R0227:Myo9b UTSW 8 71,796,806 (GRCm39) missense probably damaging 1.00
R0244:Myo9b UTSW 8 71,774,457 (GRCm39) missense probably damaging 1.00
R0277:Myo9b UTSW 8 71,808,596 (GRCm39) splice site probably benign
R0362:Myo9b UTSW 8 71,800,414 (GRCm39) missense probably damaging 1.00
R0689:Myo9b UTSW 8 71,783,400 (GRCm39) missense probably damaging 1.00
R0844:Myo9b UTSW 8 71,743,119 (GRCm39) missense probably benign 0.37
R1051:Myo9b UTSW 8 71,808,466 (GRCm39) missense probably damaging 1.00
R1469:Myo9b UTSW 8 71,743,680 (GRCm39) missense probably damaging 1.00
R1469:Myo9b UTSW 8 71,743,680 (GRCm39) missense probably damaging 1.00
R1526:Myo9b UTSW 8 71,808,408 (GRCm39) missense probably damaging 1.00
R1544:Myo9b UTSW 8 71,743,620 (GRCm39) missense probably damaging 1.00
R1565:Myo9b UTSW 8 71,767,836 (GRCm39) missense possibly damaging 0.46
R1645:Myo9b UTSW 8 71,775,622 (GRCm39) missense probably damaging 1.00
R1745:Myo9b UTSW 8 71,806,691 (GRCm39) missense probably damaging 1.00
R1820:Myo9b UTSW 8 71,786,002 (GRCm39) missense probably damaging 1.00
R2037:Myo9b UTSW 8 71,743,510 (GRCm39) missense probably damaging 1.00
R2050:Myo9b UTSW 8 71,743,194 (GRCm39) missense probably damaging 1.00
R2056:Myo9b UTSW 8 71,812,334 (GRCm39) missense possibly damaging 0.78
R2129:Myo9b UTSW 8 71,786,343 (GRCm39) missense probably damaging 1.00
R2423:Myo9b UTSW 8 71,780,584 (GRCm39) missense probably damaging 1.00
R2869:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2869:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2871:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2871:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2872:Myo9b UTSW 8 71,743,610 (GRCm39) missense probably benign 0.01
R2872:Myo9b UTSW 8 71,743,610 (GRCm39) missense probably benign 0.01
R2873:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2874:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2920:Myo9b UTSW 8 71,778,501 (GRCm39) missense probably damaging 0.98
R2926:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2939:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2940:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3033:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3040:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3689:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3691:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3735:Myo9b UTSW 8 71,801,241 (GRCm39) missense probably benign 0.00
R4194:Myo9b UTSW 8 71,812,268 (GRCm39) missense possibly damaging 0.71
R4258:Myo9b UTSW 8 71,808,409 (GRCm39) missense probably damaging 1.00
R4457:Myo9b UTSW 8 71,743,643 (GRCm39) missense probably damaging 1.00
R4478:Myo9b UTSW 8 71,743,725 (GRCm39) missense probably damaging 1.00
R4496:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R4544:Myo9b UTSW 8 71,780,585 (GRCm39) missense probably damaging 1.00
R4580:Myo9b UTSW 8 71,767,779 (GRCm39) missense probably damaging 1.00
R4736:Myo9b UTSW 8 71,809,236 (GRCm39) missense probably damaging 1.00
R5068:Myo9b UTSW 8 71,801,699 (GRCm39) missense probably damaging 1.00
R5124:Myo9b UTSW 8 71,808,483 (GRCm39) missense probably damaging 1.00
R5194:Myo9b UTSW 8 71,801,733 (GRCm39) missense probably benign 0.01
R5296:Myo9b UTSW 8 71,786,032 (GRCm39) missense possibly damaging 0.69
R5528:Myo9b UTSW 8 71,775,918 (GRCm39) missense probably benign 0.06
R5664:Myo9b UTSW 8 71,812,526 (GRCm39) missense probably benign 0.13
R5677:Myo9b UTSW 8 71,796,330 (GRCm39) missense probably damaging 1.00
R5680:Myo9b UTSW 8 71,743,016 (GRCm39) missense probably benign 0.00
R5982:Myo9b UTSW 8 71,801,040 (GRCm39) missense probably benign 0.05
R6344:Myo9b UTSW 8 71,780,558 (GRCm39) missense probably damaging 1.00
R6352:Myo9b UTSW 8 71,801,055 (GRCm39) missense probably benign
R6352:Myo9b UTSW 8 71,801,054 (GRCm39) missense probably benign 0.16
R6411:Myo9b UTSW 8 71,775,599 (GRCm39) nonsense probably null
R6425:Myo9b UTSW 8 71,786,272 (GRCm39) missense probably damaging 1.00
R6505:Myo9b UTSW 8 71,808,501 (GRCm39) missense possibly damaging 0.88
R6743:Myo9b UTSW 8 71,804,803 (GRCm39) splice site probably null
R6811:Myo9b UTSW 8 71,809,222 (GRCm39) missense probably damaging 1.00
R6813:Myo9b UTSW 8 71,775,949 (GRCm39) missense probably damaging 1.00
R6954:Myo9b UTSW 8 71,743,463 (GRCm39) missense probably damaging 1.00
R7124:Myo9b UTSW 8 71,786,345 (GRCm39) nonsense probably null
R7255:Myo9b UTSW 8 71,743,535 (GRCm39) missense probably damaging 1.00
R7293:Myo9b UTSW 8 71,778,549 (GRCm39) missense probably benign 0.00
R7342:Myo9b UTSW 8 71,808,418 (GRCm39) missense probably damaging 1.00
R7451:Myo9b UTSW 8 71,804,832 (GRCm39) missense probably benign 0.28
R7482:Myo9b UTSW 8 71,795,442 (GRCm39) missense probably benign 0.00
R7508:Myo9b UTSW 8 71,807,445 (GRCm39) missense probably benign 0.00
R7957:Myo9b UTSW 8 71,807,405 (GRCm39) missense probably benign 0.12
R8062:Myo9b UTSW 8 71,774,457 (GRCm39) missense probably damaging 0.99
R8108:Myo9b UTSW 8 71,800,986 (GRCm39) missense probably damaging 0.99
R8197:Myo9b UTSW 8 71,743,607 (GRCm39) missense probably damaging 1.00
R8274:Myo9b UTSW 8 71,812,480 (GRCm39) missense probably benign 0.00
R8686:Myo9b UTSW 8 71,786,966 (GRCm39) missense probably benign 0.01
R8731:Myo9b UTSW 8 71,806,486 (GRCm39) critical splice donor site probably null
R8924:Myo9b UTSW 8 71,801,675 (GRCm39) missense probably benign
R9056:Myo9b UTSW 8 71,804,906 (GRCm39) missense probably benign 0.17
R9117:Myo9b UTSW 8 71,800,451 (GRCm39) missense probably benign 0.03
R9151:Myo9b UTSW 8 71,807,871 (GRCm39) splice site probably benign
R9315:Myo9b UTSW 8 71,801,811 (GRCm39) missense possibly damaging 0.54
R9332:Myo9b UTSW 8 71,812,246 (GRCm39) missense probably benign 0.07
R9364:Myo9b UTSW 8 71,808,483 (GRCm39) missense probably damaging 1.00
R9581:Myo9b UTSW 8 71,812,543 (GRCm39) missense probably benign 0.19
R9600:Myo9b UTSW 8 71,743,075 (GRCm39) missense possibly damaging 0.80
X0066:Myo9b UTSW 8 71,776,542 (GRCm39) missense probably damaging 1.00
Z1177:Myo9b UTSW 8 71,743,353 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCCCACTAGATTCCTGTG -3'
(R):5'- GCTGTTCCTGCCTAGAACAC -3'

Sequencing Primer
(F):5'- TCCTCTGGACAAAGAGCACTGTATG -3'
(R):5'- TAGAACACCCGCCTGGACG -3'
Posted On 2022-08-09