Mutagenetix > Incidental Mutation

Incidental Mutation 'R9569:Umodl1'

721877

Institutional Source

Beutler Lab

Gene Symbol

Umodl1

Ensembl Gene

ENSMUSG00000054134

Gene Name

uromodulin-like 1

Synonyms

D17Ertd488e

MMRRC Submission

068966-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9569 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30954679-31010708 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30998169 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1125 (Y1125C)

Ref Sequence

ENSEMBL: ENSMUSP00000067443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]

AlphaFold

Q5DID3

Predicted Effect

probably damaging
Transcript: ENSMUST00000066554
AA Change: Y1125C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: Y1125C

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000066981
AA Change: Y1010C

SMART Domains

Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: Y1010C

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	8.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	8.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	619	632	N/A	INTRINSIC
SEA	706	821	8.88e-2	SMART
EGF	818	859	4.26e0	SMART
ZP	909	1152	5.44e-25	SMART
transmembrane domain	1186	1208	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114555
AA Change: Y1125C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: Y1125C

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	9.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	9.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	G	C	4: 42,971,740	V358L	probably benign	Het
4932438A13Rik	T	C	3: 37,012,621	M211T		Het
Abi2	T	A	1: 60,464,604	V356D	probably damaging	Het
Adgrd1	T	C	5: 129,179,637	V690A	possibly damaging	Het
Apba2	T	C	7: 64,743,390	M553T	possibly damaging	Het
Apeh	C	T	9: 108,094,410	V13M	unknown	Het
Apol11b	C	T	15: 77,640,571	E5K	possibly damaging	Het
Apol7e	C	T	15: 77,717,733	T177I	probably damaging	Het
Bub1b	T	C	2: 118,638,403	I883T	probably damaging	Het
C9	T	C	15: 6,459,581	S140P	probably damaging	Het
Cbfa2t2	T	A	2: 154,504,565	I64N	probably benign	Het
Cd180	A	T	13: 102,705,978	I511F	possibly damaging	Het
Cic	T	C	7: 25,272,695	V617A	possibly damaging	Het
Clca3a2	A	C	3: 144,807,314		probably null	Het
D5Ertd579e	T	C	5: 36,602,635	T1394A	probably damaging	Het
Dclk1	A	T	3: 55,480,431	E422D	probably benign	Het
Depdc5	A	T	5: 32,867,977	D21V	probably damaging	Het
Dis3l	A	G	9: 64,329,547	F40S	unknown	Het
Duox1	T	C	2: 122,318,490	V82A	probably benign	Het
Dus2	T	C	8: 106,044,875	V211A	probably damaging	Het
Eif2ak4	G	A	2: 118,420,835	S326N	probably benign	Het
Fat3	A	C	9: 15,919,199	L153R		Het
Gpx8	C	T	13: 113,045,591	V103I	probably damaging	Het
Gtf2a1l	A	G	17: 88,694,520	D268G	probably benign	Het
Hc	T	C	2: 35,036,347	I342V	probably benign	Het
Hsp90ab1	T	A	17: 45,568,952	D546V	possibly damaging	Het
Ifi206	T	G	1: 173,486,643	D77A		Het
Igfbp1	A	G	11: 7,197,881		probably benign	Het
Kdm3a	T	C	6: 71,607,450	D559G	probably benign	Het
Kif2a	A	G	13: 106,968,738	I565T	probably benign	Het
Krt2	T	C	15: 101,816,489	T229A	probably damaging	Het
Lcmt2	G	A	2: 121,140,041	A187V	probably damaging	Het
Mapk8ip1	A	G	2: 92,387,254	M241T	probably benign	Het
Mup15	T	C	4: 61,439,638		probably benign	Het
Myo9b	T	C	8: 71,358,985	V1912A	probably benign	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Naip5	T	C	13: 100,223,313	T472A	probably benign	Het
Net1	A	G	13: 3,888,518	F123S	probably benign	Het
Olfr183	A	G	16: 58,999,865	Y60C	probably damaging	Het
Olfr335-ps	T	C	2: 36,301,934	Y132H	probably damaging	Het
Olfr666	C	T	7: 104,893,318	M103I	possibly damaging	Het
Pcdhb13	T	C	18: 37,443,100	F177S	probably damaging	Het
Pclo	T	C	5: 14,857,051		probably null	Het
Perm1	A	G	4: 156,218,582	T528A	probably benign	Het
Pik3c2a	C	T	7: 116,358,704	A1116T	possibly damaging	Het
Prox2	G	A	12: 85,094,992	Q146*	probably null	Het
Psd	A	T	19: 46,320,278	C639S	possibly damaging	Het
Rffl	T	A	11: 82,812,438	T220S	probably benign	Het
Scn2a	A	G	2: 65,730,278	D1284G	probably damaging	Het
Scube1	T	C	15: 83,629,404	Y385C	probably damaging	Het
Sec14l3	A	T	11: 4,076,324	D388V	probably damaging	Het
Slc26a1	G	T	5: 108,671,594	Q596K	probably benign	Het
Slc6a19	T	C	13: 73,685,911	T343A	probably benign	Het
Slc7a4	A	G	16: 17,575,398	V179A		Het
Sox14	T	G	9: 99,875,509	D49A		Het
Timm22	A	G	11: 76,407,370	S56G	probably benign	Het
Tmub2	G	A	11: 102,288,327	W322*	probably null	Het
Tsc22d4	A	G	5: 137,758,166	T8A	probably benign	Het
Ttn	T	C	2: 76,709,308	I34445V	probably benign	Het
Tyms	A	T	5: 30,063,362	Y196*	probably null	Het
Ube2o	G	A	11: 116,543,997	T546M	probably damaging	Het
Unc13b	CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC	CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC	4: 43,177,312		probably benign	Het
Unk	A	T	11: 116,059,209	Q747L	probably damaging	Het
Vmn1r170	A	G	7: 23,606,869	E232G	probably benign	Het
Vps41	A	G	13: 18,829,226	Y338C	possibly damaging	Het
Washc5	T	C	15: 59,344,131	M800V	probably benign	Het
Wt1	T	A	2: 105,163,366	I348N	possibly damaging	Het
Xirp2	A	G	2: 67,510,898	Y1161C	probably damaging	Het
Xpo7	A	G	14: 70,668,700	M1001T	possibly damaging	Het
Yeats2	A	T	16: 20,154,152	R19W	probably damaging	Het
Zfp142	T	C	1: 74,576,227	T476A	probably damaging	Het
Zfp229	T	C	17: 21,745,592	W268R	possibly damaging	Het
Zfp473	A	G	7: 44,739,547	F50S	probably damaging	Het
Zfp975	A	T	7: 42,661,989	M400K	probably benign	Het
Zkscan5	A	G	5: 145,207,609	M150V	probably benign	Het
Znfx1	T	A	2: 167,055,955	I350F		Het

Other mutations in Umodl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Umodl1	APN	17	31008750	utr 3 prime	probably benign
IGL01344:Umodl1	APN	17	30996264	missense	probably damaging	0.99
IGL01529:Umodl1	APN	17	30996259	missense	possibly damaging	0.94
IGL01609:Umodl1	APN	17	30998826	missense	possibly damaging	0.90
IGL01625:Umodl1	APN	17	30996255	missense	probably benign	0.00
IGL01877:Umodl1	APN	17	30982320	missense	probably benign	0.00
IGL01977:Umodl1	APN	17	30973768	missense	probably damaging	0.99
IGL02063:Umodl1	APN	17	30987914	missense	probably benign	0.07
IGL02160:Umodl1	APN	17	30986117	missense	probably damaging	0.97
IGL02252:Umodl1	APN	17	30994815	critical splice donor site	probably null
IGL02427:Umodl1	APN	17	30968441	splice site	probably benign
IGL02496:Umodl1	APN	17	30998654	missense	probably damaging	0.99
IGL02633:Umodl1	APN	17	30989488	missense	probably damaging	1.00
IGL03271:Umodl1	APN	17	30986499	nonsense	probably null
IGL03392:Umodl1	APN	17	30996355	missense	probably damaging	0.98
Disquieting	UTSW	17	30959155	missense	probably damaging	1.00
floored	UTSW	17	30988057	nonsense	probably null
R7231_umodl1_507	UTSW	17	30986116	missense	probably damaging	1.00
surprising	UTSW	17	30986465	missense	possibly damaging	0.77
unsettling	UTSW	17	30986554	nonsense	probably null
G1citation:Umodl1	UTSW	17	30986554	nonsense	probably null
PIT4468001:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0653:Umodl1	UTSW	17	30984028	missense	probably benign	0.00
R0831:Umodl1	UTSW	17	30996351	missense	probably damaging	1.00
R1078:Umodl1	UTSW	17	30959373	missense	probably benign	0.00
R1166:Umodl1	UTSW	17	31002798	splice site	probably benign
R1231:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R1459:Umodl1	UTSW	17	30982258	splice site	probably benign
R1459:Umodl1	UTSW	17	30986504	missense	probably benign	0.05
R1510:Umodl1	UTSW	17	30959229	missense	probably damaging	1.00
R1654:Umodl1	UTSW	17	30987968	missense	probably benign
R1757:Umodl1	UTSW	17	31008700	missense	probably damaging	0.99
R1781:Umodl1	UTSW	17	30968550	missense	probably damaging	1.00
R1873:Umodl1	UTSW	17	30982264	missense	probably damaging	0.99
R1911:Umodl1	UTSW	17	30992154	missense	possibly damaging	0.74
R1917:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R1918:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R2057:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2058:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2089:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2431:Umodl1	UTSW	17	30992088	missense	possibly damaging	0.79
R2903:Umodl1	UTSW	17	30992173	missense	probably damaging	1.00
R3032:Umodl1	UTSW	17	30989528	missense	probably benign	0.01
R3956:Umodl1	UTSW	17	31002863	missense	probably benign	0.10
R3975:Umodl1	UTSW	17	30984789	nonsense	probably null
R4207:Umodl1	UTSW	17	30959367	missense	probably damaging	1.00
R4287:Umodl1	UTSW	17	30988065	missense	probably benign	0.11
R4452:Umodl1	UTSW	17	30994815	critical splice donor site	probably null
R4684:Umodl1	UTSW	17	30998114	missense	probably benign	0.00
R4769:Umodl1	UTSW	17	30984002	missense	possibly damaging	0.92
R4887:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R4888:Umodl1	UTSW	17	30999201	missense	probably damaging	1.00
R4978:Umodl1	UTSW	17	30986081	missense	probably benign
R4993:Umodl1	UTSW	17	30986485	missense	probably benign	0.00
R5241:Umodl1	UTSW	17	30984092	missense	probably benign	0.18
R5254:Umodl1	UTSW	17	30980359	missense	possibly damaging	0.86
R5454:Umodl1	UTSW	17	30986465	missense	possibly damaging	0.77
R5456:Umodl1	UTSW	17	30982289	missense	probably benign	0.04
R5754:Umodl1	UTSW	17	30994787	missense	probably damaging	0.96
R6189:Umodl1	UTSW	17	30996282	missense	possibly damaging	0.75
R6222:Umodl1	UTSW	17	31002892	critical splice donor site	probably null
R6289:Umodl1	UTSW	17	30982351	missense	probably benign	0.16
R6432:Umodl1	UTSW	17	30986147	missense	probably benign	0.38
R6478:Umodl1	UTSW	17	30959155	missense	probably damaging	1.00
R6702:Umodl1	UTSW	17	30986299	splice site	probably null
R6822:Umodl1	UTSW	17	30986554	nonsense	probably null
R6999:Umodl1	UTSW	17	30999123	missense	probably damaging	1.00
R7067:Umodl1	UTSW	17	30982272	missense	probably damaging	1.00
R7123:Umodl1	UTSW	17	30982344	missense	possibly damaging	0.90
R7219:Umodl1	UTSW	17	30982262	critical splice acceptor site	probably null
R7231:Umodl1	UTSW	17	30986116	missense	probably damaging	1.00
R7234:Umodl1	UTSW	17	30986621	missense	possibly damaging	0.87
R7297:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R7392:Umodl1	UTSW	17	30982332	missense	probably damaging	0.99
R7401:Umodl1	UTSW	17	30998148	missense	probably damaging	1.00
R7461:Umodl1	UTSW	17	30988057	nonsense	probably null
R7594:Umodl1	UTSW	17	30954805	missense	probably benign	0.02
R7613:Umodl1	UTSW	17	30988057	nonsense	probably null
R7763:Umodl1	UTSW	17	30986456	missense	probably benign	0.24
R7797:Umodl1	UTSW	17	30959151	missense	probably benign	0.02
R7832:Umodl1	UTSW	17	30973692	critical splice acceptor site	probably null
R7954:Umodl1	UTSW	17	30986387	missense	probably benign	0.00
R8088:Umodl1	UTSW	17	30973796	missense	probably benign	0.29
R8111:Umodl1	UTSW	17	30971818	missense	probably damaging	0.99
R8314:Umodl1	UTSW	17	30984832	missense	probably damaging	0.99
R8826:Umodl1	UTSW	17	30983984	missense	possibly damaging	0.65
R9067:Umodl1	UTSW	17	30973703	missense	probably damaging	1.00
R9091:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9099:Umodl1	UTSW	17	30959173	missense	probably benign	0.01
R9270:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9341:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9343:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9400:Umodl1	UTSW	17	30996393	missense	probably damaging	0.99
R9615:Umodl1	UTSW	17	30998178	missense	possibly damaging	0.94
R9787:Umodl1	UTSW	17	30959350	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCCCAGGAGATCACTTACATC -3'
(R):5'- TAACTCCTCTCTGTGTGGGAGG -3'

Sequencing Primer
(F):5'- CAGGAGATCACTTACATCTTGTCTG -3'
(R):5'- AGAAGCTGTTCCTCCTAGCTGATTG -3'

Posted On

2022-08-09