Incidental Mutation 'R9570:Atp8b3'
ID 721929
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene Name ATPase, class I, type 8B, member 3
Synonyms 1700042F02Rik, 1700056N23Rik, SAPLT
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R9570 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 80355418-80374958 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80361822 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 743 (F743S)
Ref Sequence ENSEMBL: ENSMUSP00000020383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]
AlphaFold Q6UQ17
Predicted Effect probably benign
Transcript: ENSMUST00000020383
AA Change: F743S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: F743S

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220326
AA Change: F743S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 C T 8: 41,277,687 (GRCm39) T26I probably benign Het
Adgrg7 A G 16: 56,570,813 (GRCm39) L405P probably damaging Het
Ankle1 A G 8: 71,859,424 (GRCm39) D106G probably damaging Het
Ankrd17 G T 5: 90,401,536 (GRCm39) D1609E Het
Anpep A G 7: 79,476,661 (GRCm39) V772A probably benign Het
Anxa8 T C 14: 33,814,509 (GRCm39) V115A possibly damaging Het
Aoc1 T C 6: 48,882,772 (GRCm39) F216S probably damaging Het
Aplf T A 6: 87,640,781 (GRCm39) E76V possibly damaging Het
Apol11b C T 15: 77,524,771 (GRCm39) E5K possibly damaging Het
Arhgap42 T A 9: 9,148,209 (GRCm39) Y120F Het
Atg2a T A 19: 6,305,749 (GRCm39) H1316Q probably benign Het
Best1 A T 19: 9,970,331 (GRCm39) W94R probably damaging Het
Catsper3 T C 13: 55,953,669 (GRCm39) probably null Het
Ccdc80 A T 16: 44,915,449 (GRCm39) E68D probably benign Het
Col8a1 T A 16: 57,448,539 (GRCm39) I324F unknown Het
Coro1c G A 5: 114,003,816 (GRCm39) R68* probably null Het
Dennd4c A G 4: 86,747,208 (GRCm39) D1464G possibly damaging Het
Dgat2 C T 7: 98,818,926 (GRCm39) V77I possibly damaging Het
Ecpas G A 4: 58,832,796 (GRCm39) R855* probably null Het
Ednra A C 8: 78,393,961 (GRCm39) N378K possibly damaging Het
Eif1ad4 A G 12: 87,862,534 (GRCm39) D132G unknown Het
Eml5 A T 12: 98,782,243 (GRCm39) D178E probably benign Het
Ethe1 G T 7: 24,293,236 (GRCm39) probably benign Het
Fgf21 C T 7: 45,264,594 (GRCm39) R46Q probably damaging Het
Flt3 C T 5: 147,309,424 (GRCm39) V198M possibly damaging Het
Fryl T C 5: 73,179,498 (GRCm39) N2970D probably benign Het
Gtf2e2 T A 8: 34,252,076 (GRCm39) D197E probably damaging Het
Gtf2i G A 5: 134,294,627 (GRCm39) R362W probably damaging Het
Gtpbp10 C T 5: 5,596,382 (GRCm39) G188R probably damaging Het
Gzmc A C 14: 56,469,042 (GRCm39) S226A probably benign Het
Hhatl A T 9: 121,613,282 (GRCm39) V471D possibly damaging Het
Hoxd11 T C 2: 74,512,812 (GRCm39) S26P possibly damaging Het
Ighv1-85 A T 12: 115,963,794 (GRCm39) W69R probably benign Het
Kcnk3 T C 5: 30,779,433 (GRCm39) L161P possibly damaging Het
Klk6 A G 7: 43,477,967 (GRCm39) D113G probably damaging Het
Map3k5 A G 10: 19,876,314 (GRCm39) I158V probably benign Het
Marchf8 T A 6: 116,382,639 (GRCm39) M434K probably benign Het
Mcc T C 18: 44,578,925 (GRCm39) R828G probably damaging Het
Muc4 A T 16: 32,569,695 (GRCm39) T252S possibly damaging Het
Naip5 T C 13: 100,359,821 (GRCm39) T472A probably benign Het
Nme7 A G 1: 164,206,961 (GRCm39) D282G probably benign Het
Npdc1 G T 2: 25,298,312 (GRCm39) A228S probably benign Het
Nrbp1 T A 5: 31,401,272 (GRCm39) S49R probably damaging Het
Ntan1 T C 16: 13,637,248 (GRCm39) V10A possibly damaging Het
Or10a3 A G 7: 108,480,504 (GRCm39) V103A possibly damaging Het
Or10b1 T C 10: 78,356,084 (GRCm39) V214A probably benign Het
Or51b4 A G 7: 103,530,856 (GRCm39) V198A probably benign Het
Pdcd2l T C 7: 33,892,401 (GRCm39) D156G probably benign Het
Pde11a A G 2: 75,877,157 (GRCm39) S771P probably damaging Het
Pilra T A 5: 137,834,342 (GRCm39) M14L probably benign Het
Pkd1l1 T A 11: 8,840,697 (GRCm39) E1237V Het
Pkp2 A T 16: 16,078,278 (GRCm39) T507S possibly damaging Het
Polm A G 11: 5,779,713 (GRCm39) Y362H probably damaging Het
Pramel12 A T 4: 143,144,514 (GRCm39) M287L probably benign Het
Prcd C T 11: 116,550,583 (GRCm39) S85F possibly damaging Het
Prox2 G A 12: 85,141,766 (GRCm39) Q146* probably null Het
Ptger1 T C 8: 84,395,461 (GRCm39) W313R probably damaging Het
Ptpn23 T C 9: 110,227,217 (GRCm39) E44G probably damaging Het
Rai1 A G 11: 60,076,568 (GRCm39) T211A probably benign Het
Rgl1 C A 1: 152,430,082 (GRCm39) D234Y possibly damaging Het
Rlf A G 4: 121,007,087 (GRCm39) V741A possibly damaging Het
Rnaseh2b T C 14: 62,597,978 (GRCm39) probably null Het
Selenon C T 4: 134,270,055 (GRCm39) R383H probably benign Het
Sh3rf2 A T 18: 42,272,620 (GRCm39) H368L possibly damaging Het
Slc9c1 A T 16: 45,380,705 (GRCm39) I544L probably benign Het
Smarca4 A G 9: 21,580,849 (GRCm39) E993G probably damaging Het
Stab1 T A 14: 30,864,638 (GRCm39) I1966F probably benign Het
Stard9 G A 2: 120,534,714 (GRCm39) S3657N probably benign Het
Tex15 G A 8: 34,067,309 (GRCm39) M2246I probably damaging Het
Ttc41 A T 10: 86,549,598 (GRCm39) N264I possibly damaging Het
Use1 T A 8: 71,820,473 (GRCm39) M96K possibly damaging Het
Vmn1r201 T C 13: 22,659,236 (GRCm39) I150T probably damaging Het
Vmn1r34 T C 6: 66,614,718 (GRCm39) I7V probably benign Het
Vps8 T A 16: 21,462,953 (GRCm39) F1406Y probably benign Het
Zfp788 A T 7: 41,300,006 (GRCm39) T881S possibly damaging Het
Zfp804a C T 2: 82,088,844 (GRCm39) T891I probably benign Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80,366,821 (GRCm39) missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80,361,998 (GRCm39) splice site probably benign
IGL00904:Atp8b3 APN 10 80,364,598 (GRCm39) missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80,360,210 (GRCm39) missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80,370,063 (GRCm39) splice site probably benign
IGL01448:Atp8b3 APN 10 80,356,256 (GRCm39) missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80,366,802 (GRCm39) nonsense probably null
IGL01754:Atp8b3 APN 10 80,366,795 (GRCm39) splice site probably null
IGL01809:Atp8b3 APN 10 80,355,845 (GRCm39) missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80,357,662 (GRCm39) missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80,363,067 (GRCm39) splice site probably benign
IGL02224:Atp8b3 APN 10 80,361,810 (GRCm39) splice site probably benign
IGL02377:Atp8b3 APN 10 80,356,128 (GRCm39) missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80,366,462 (GRCm39) missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80,366,438 (GRCm39) missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80,370,292 (GRCm39) missense probably damaging 1.00
PIT4544001:Atp8b3 UTSW 10 80,366,420 (GRCm39) missense probably benign 0.14
R0277:Atp8b3 UTSW 10 80,362,743 (GRCm39) missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80,355,918 (GRCm39) missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80,370,032 (GRCm39) missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80,366,852 (GRCm39) missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80,356,017 (GRCm39) missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80,368,376 (GRCm39) missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80,361,619 (GRCm39) missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80,357,635 (GRCm39) splice site probably null
R1717:Atp8b3 UTSW 10 80,364,631 (GRCm39) missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80,365,912 (GRCm39) missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80,361,220 (GRCm39) nonsense probably null
R2138:Atp8b3 UTSW 10 80,362,939 (GRCm39) missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80,366,822 (GRCm39) missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80,362,728 (GRCm39) missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80,370,017 (GRCm39) missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80,355,746 (GRCm39) missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80,362,014 (GRCm39) missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80,365,540 (GRCm39) missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4518:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4519:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4619:Atp8b3 UTSW 10 80,361,858 (GRCm39) missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80,361,457 (GRCm39) missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80,372,604 (GRCm39) splice site probably null
R4774:Atp8b3 UTSW 10 80,372,156 (GRCm39) missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80,360,188 (GRCm39) missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80,357,676 (GRCm39) missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80,365,533 (GRCm39) missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80,356,007 (GRCm39) missense probably benign
R5990:Atp8b3 UTSW 10 80,361,531 (GRCm39) missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80,365,515 (GRCm39) missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80,356,157 (GRCm39) splice site probably null
R6748:Atp8b3 UTSW 10 80,361,058 (GRCm39) missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80,361,895 (GRCm39) missense possibly damaging 0.76
R7051:Atp8b3 UTSW 10 80,365,552 (GRCm39) missense probably damaging 0.99
R7051:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7052:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7418:Atp8b3 UTSW 10 80,365,926 (GRCm39) missense probably damaging 0.99
R7426:Atp8b3 UTSW 10 80,365,463 (GRCm39) critical splice donor site probably null
R7625:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign 0.00
R7673:Atp8b3 UTSW 10 80,360,240 (GRCm39) missense probably damaging 0.99
R7921:Atp8b3 UTSW 10 80,366,437 (GRCm39) missense probably damaging 1.00
R8077:Atp8b3 UTSW 10 80,366,858 (GRCm39) missense possibly damaging 0.95
R8235:Atp8b3 UTSW 10 80,365,650 (GRCm39) missense probably damaging 0.96
R8354:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8454:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8501:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign
R8712:Atp8b3 UTSW 10 80,365,923 (GRCm39) missense possibly damaging 0.52
R8962:Atp8b3 UTSW 10 80,355,896 (GRCm39) missense probably benign 0.13
R9129:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R9333:Atp8b3 UTSW 10 80,360,180 (GRCm39) missense probably benign 0.01
R9438:Atp8b3 UTSW 10 80,361,409 (GRCm39) missense probably damaging 1.00
R9486:Atp8b3 UTSW 10 80,366,821 (GRCm39) missense probably damaging 1.00
R9554:Atp8b3 UTSW 10 80,360,197 (GRCm39) missense probably damaging 1.00
R9682:Atp8b3 UTSW 10 80,371,230 (GRCm39) missense probably damaging 1.00
R9748:Atp8b3 UTSW 10 80,364,407 (GRCm39) missense probably damaging 0.96
RF006:Atp8b3 UTSW 10 80,362,070 (GRCm39) missense probably benign 0.15
Z1177:Atp8b3 UTSW 10 80,366,911 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGAAGTCTAACGCGGACAC -3'
(R):5'- AAGTAAGCAGGTGACCTCCC -3'

Sequencing Primer
(F):5'- ACCACTGCATTCTGGACTAGG -3'
(R):5'- CTGGTACCCACACACCGTC -3'
Posted On 2022-08-09