Incidental Mutation 'R9570:Eml5'
ID 721937
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Name echinoderm microtubule associated protein like 5
Synonyms C130068M19Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock # R9570 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 98786805-98901484 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 98815984 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 178 (D178E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]
AlphaFold Q8BQM8
Predicted Effect probably benign
Transcript: ENSMUST00000065716
AA Change: D1349E

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: D1349E

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222128
AA Change: D178E

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably damaging
Transcript: ENSMUST00000223282
AA Change: D1396E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 C T 8: 40,824,650 T26I probably benign Het
Adgrg7 A G 16: 56,750,450 L405P probably damaging Het
AI314180 G A 4: 58,832,796 R855* probably null Het
Ankle1 A G 8: 71,406,780 D106G probably damaging Het
Ankrd17 G T 5: 90,253,677 D1609E Het
Anpep A G 7: 79,826,913 V772A probably benign Het
Anxa8 T C 14: 34,092,552 V115A possibly damaging Het
Aoc1 T C 6: 48,905,838 F216S probably damaging Het
Aplf T A 6: 87,663,799 E76V possibly damaging Het
Apol11b C T 15: 77,640,571 E5K possibly damaging Het
Arhgap42 T A 9: 9,148,208 Y120F Het
Atg2a T A 19: 6,255,719 H1316Q probably benign Het
Atp8b3 A G 10: 80,525,988 F743S probably benign Het
Best1 A T 19: 9,992,967 W94R probably damaging Het
Catsper3 T C 13: 55,805,856 probably null Het
Ccdc80 A T 16: 45,095,086 E68D probably benign Het
Col8a1 T A 16: 57,628,176 I324F unknown Het
Coro1c G A 5: 113,865,755 R68* probably null Het
Dennd4c A G 4: 86,828,971 D1464G possibly damaging Het
Dgat2 C T 7: 99,169,719 V77I possibly damaging Het
Ednra A C 8: 77,667,332 N378K possibly damaging Het
Ethe1 G T 7: 24,593,811 probably benign Het
Fgf21 C T 7: 45,615,170 R46Q probably damaging Het
Flt3 C T 5: 147,372,614 V198M possibly damaging Het
Fryl T C 5: 73,022,155 N2970D probably benign Het
Gm2022 A G 12: 87,895,764 D132G unknown Het
Gtf2e2 T A 8: 33,762,048 D197E probably damaging Het
Gtf2i G A 5: 134,265,773 R362W probably damaging Het
Gtpbp10 C T 5: 5,546,382 G188R probably damaging Het
Gzmc A C 14: 56,231,585 S226A probably benign Het
Hhatl A T 9: 121,784,216 V471D possibly damaging Het
Hoxd11 T C 2: 74,682,468 S26P possibly damaging Het
Ighv1-85 A T 12: 116,000,174 W69R probably benign Het
Kcnk3 T C 5: 30,622,089 L161P possibly damaging Het
Klk6 A G 7: 43,828,543 D113G probably damaging Het
Map3k5 A G 10: 20,000,568 I158V probably benign Het
March8 T A 6: 116,405,678 M434K probably benign Het
Mcc T C 18: 44,445,858 R828G probably damaging Het
Muc4 A T 16: 32,750,877 T252S possibly damaging Het
Naip5 T C 13: 100,223,313 T472A probably benign Het
Nme7 A G 1: 164,379,392 D282G probably benign Het
Npdc1 G T 2: 25,408,300 A228S probably benign Het
Nrbp1 T A 5: 31,243,928 S49R probably damaging Het
Ntan1 T C 16: 13,819,384 V10A possibly damaging Het
Olfr1358 T C 10: 78,520,250 V214A probably benign Het
Olfr518 A G 7: 108,881,297 V103A possibly damaging Het
Olfr66 A G 7: 103,881,649 V198A probably benign Het
Pdcd2l T C 7: 34,192,976 D156G probably benign Het
Pde11a A G 2: 76,046,813 S771P probably damaging Het
Pilra T A 5: 137,836,080 M14L probably benign Het
Pkd1l1 T A 11: 8,890,697 E1237V Het
Pkp2 A T 16: 16,260,414 T507S possibly damaging Het
Polm A G 11: 5,829,713 Y362H probably damaging Het
Pramef8 A T 4: 143,417,944 M287L probably benign Het
Prcd C T 11: 116,659,757 S85F possibly damaging Het
Prox2 G A 12: 85,094,992 Q146* probably null Het
Ptger1 T C 8: 83,668,832 W313R probably damaging Het
Ptpn23 T C 9: 110,398,149 E44G probably damaging Het
Rai1 A G 11: 60,185,742 T211A probably benign Het
Rgl1 C A 1: 152,554,331 D234Y possibly damaging Het
Rlf A G 4: 121,149,890 V741A possibly damaging Het
Rnaseh2b T C 14: 62,360,529 probably null Het
Selenon C T 4: 134,542,744 R383H probably benign Het
Sh3rf2 A T 18: 42,139,555 H368L possibly damaging Het
Slc9c1 A T 16: 45,560,342 I544L probably benign Het
Smarca4 A G 9: 21,669,553 E993G probably damaging Het
Stab1 T A 14: 31,142,681 I1966F probably benign Het
Stard9 G A 2: 120,704,233 S3657N probably benign Het
Tex15 G A 8: 33,577,281 M2246I probably damaging Het
Ttc41 A T 10: 86,713,734 N264I possibly damaging Het
Use1 T A 8: 71,367,829 M96K possibly damaging Het
Vmn1r201 T C 13: 22,475,066 I150T probably damaging Het
Vmn1r34 T C 6: 66,637,734 I7V probably benign Het
Vps8 T A 16: 21,644,203 F1406Y probably benign Het
Zfp788 A T 7: 41,650,582 T881S possibly damaging Het
Zfp804a C T 2: 82,258,500 T891I probably benign Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98873209 splice site probably benign
IGL00473:Eml5 APN 12 98805492 splice site probably benign
IGL01120:Eml5 APN 12 98844019 missense probably benign
IGL01308:Eml5 APN 12 98802313 missense probably damaging 1.00
IGL01790:Eml5 APN 12 98798932 missense probably damaging 1.00
IGL01973:Eml5 APN 12 98863280 missense probably benign
IGL02182:Eml5 APN 12 98802322 missense probably damaging 1.00
IGL02201:Eml5 APN 12 98794424 splice site probably benign
IGL02375:Eml5 APN 12 98844087 missense probably damaging 1.00
IGL02397:Eml5 APN 12 98790674 missense probably benign 0.07
IGL02480:Eml5 APN 12 98876243 missense probably damaging 1.00
IGL02801:Eml5 APN 12 98817845 missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98858841 missense probably damaging 1.00
IGL03104:Eml5 APN 12 98861245 nonsense probably null
IGL03158:Eml5 APN 12 98827514 splice site probably benign
IGL03286:Eml5 APN 12 98860503 missense probably damaging 1.00
IGL03380:Eml5 APN 12 98874647 splice site probably benign
BB010:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
BB020:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
R0573:Eml5 UTSW 12 98824772 splice site probably null
R0624:Eml5 UTSW 12 98865479 missense probably damaging 1.00
R0993:Eml5 UTSW 12 98861183 missense probably benign 0.25
R1073:Eml5 UTSW 12 98830973 missense probably damaging 1.00
R1183:Eml5 UTSW 12 98792046 missense probably benign 0.31
R1352:Eml5 UTSW 12 98831003 splice site probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1503:Eml5 UTSW 12 98831174 missense probably damaging 0.99
R1538:Eml5 UTSW 12 98794276 missense probably damaging 0.99
R1689:Eml5 UTSW 12 98830935 missense probably damaging 1.00
R1773:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1775:Eml5 UTSW 12 98852704 splice site probably null
R1791:Eml5 UTSW 12 98887056 missense probably benign 0.31
R1856:Eml5 UTSW 12 98810584 missense probably damaging 1.00
R1919:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1957:Eml5 UTSW 12 98859961 missense probably damaging 1.00
R1962:Eml5 UTSW 12 98876311 missense probably damaging 0.99
R2033:Eml5 UTSW 12 98791386 missense possibly damaging 0.71
R2035:Eml5 UTSW 12 98794266 missense probably benign 0.33
R2073:Eml5 UTSW 12 98802446 missense probably damaging 0.99
R2143:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2144:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2158:Eml5 UTSW 12 98843946 splice site probably benign
R2164:Eml5 UTSW 12 98887097 missense probably damaging 0.99
R2175:Eml5 UTSW 12 98876223 nonsense probably null
R2200:Eml5 UTSW 12 98825417 missense probably damaging 1.00
R2234:Eml5 UTSW 12 98841581 missense probably damaging 1.00
R2504:Eml5 UTSW 12 98844105 missense possibly damaging 0.71
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2958:Eml5 UTSW 12 98876178 missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98880808 splice site probably null
R3118:Eml5 UTSW 12 98865494 missense probably damaging 0.97
R3735:Eml5 UTSW 12 98855989 missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98816024 missense probably damaging 1.00
R3900:Eml5 UTSW 12 98825523 missense probably damaging 1.00
R3973:Eml5 UTSW 12 98802465 splice site probably benign
R3976:Eml5 UTSW 12 98802465 splice site probably benign
R4105:Eml5 UTSW 12 98841548 splice site probably null
R4107:Eml5 UTSW 12 98841548 splice site probably null
R4108:Eml5 UTSW 12 98841548 splice site probably null
R4109:Eml5 UTSW 12 98841548 splice site probably null
R4258:Eml5 UTSW 12 98865434 missense probably benign 0.01
R4381:Eml5 UTSW 12 98815955 missense possibly damaging 0.93
R4590:Eml5 UTSW 12 98837341 missense possibly damaging 0.91
R4737:Eml5 UTSW 12 98798852 missense probably damaging 1.00
R4775:Eml5 UTSW 12 98802307 missense probably benign 0.05
R4850:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5007:Eml5 UTSW 12 98830965 missense probably damaging 1.00
R5092:Eml5 UTSW 12 98792616 missense probably damaging 1.00
R5123:Eml5 UTSW 12 98874512 missense probably damaging 1.00
R5124:Eml5 UTSW 12 98792042 missense probably damaging 1.00
R5273:Eml5 UTSW 12 98790688 missense probably damaging 1.00
R5369:Eml5 UTSW 12 98858783 missense probably damaging 1.00
R5430:Eml5 UTSW 12 98794158 missense probably damaging 1.00
R5748:Eml5 UTSW 12 98825555 missense probably damaging 0.99
R5769:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5832:Eml5 UTSW 12 98876188 missense probably benign
R6113:Eml5 UTSW 12 98824674 nonsense probably null
R6131:Eml5 UTSW 12 98861251 missense probably damaging 0.99
R6175:Eml5 UTSW 12 98794456 missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98863129 missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98870884 missense probably damaging 0.98
R6375:Eml5 UTSW 12 98798868
R6528:Eml5 UTSW 12 98824637 missense probably benign 0.18
R6657:Eml5 UTSW 12 98791405 missense probably damaging 0.98
R6717:Eml5 UTSW 12 98827506 missense probably damaging 1.00
R6751:Eml5 UTSW 12 98865400 missense probably damaging 1.00
R6833:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6834:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6972:Eml5 UTSW 12 98876180 missense probably benign 0.00
R7091:Eml5 UTSW 12 98802474 missense probably benign 0.16
R7353:Eml5 UTSW 12 98825424 missense
R7644:Eml5 UTSW 12 98855944 missense probably benign 0.05
R7694:Eml5 UTSW 12 98792563 missense probably damaging 0.99
R7842:Eml5 UTSW 12 98794135 missense probably damaging 1.00
R7933:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
R8111:Eml5 UTSW 12 98792514 critical splice donor site probably null
R8198:Eml5 UTSW 12 98858886 nonsense probably null
R8482:Eml5 UTSW 12 98876301 missense probably damaging 1.00
R8732:Eml5 UTSW 12 98815959 missense probably damaging 0.99
R8956:Eml5 UTSW 12 98852693 missense possibly damaging 0.69
R8975:Eml5 UTSW 12 98810570 missense probably damaging 0.99
R9131:Eml5 UTSW 12 98858840 missense probably damaging 1.00
R9258:Eml5 UTSW 12 98844117 missense possibly damaging 0.77
R9261:Eml5 UTSW 12 98856028 missense probably damaging 0.99
R9276:Eml5 UTSW 12 98798801 missense probably damaging 0.99
R9301:Eml5 UTSW 12 98882033 nonsense probably null
R9368:Eml5 UTSW 12 98796578 missense probably benign 0.31
R9392:Eml5 UTSW 12 98900940 missense probably damaging 1.00
R9393:Eml5 UTSW 12 98876174 missense probably benign 0.35
R9449:Eml5 UTSW 12 98861295 missense probably damaging 1.00
T0722:Eml5 UTSW 12 98841582 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGAGACCCTGTCTTGAAAACAAAC -3'
(R):5'- ACTTTTGGGGAAGAAGAGGTTC -3'

Sequencing Primer
(F):5'- GACCCTGTCTTGAAAACAAACCAAAC -3'
(R):5'- TTTGGGGAAGAAGAGGTTCAGTGG -3'
Posted On 2022-08-09