Mutagenetix > Incidental Mutation

Incidental Mutation 'R9570:Eml5'

721937

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.225) question?

Stock #

R9570 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 98815984 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 178 (D178E)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]

AlphaFold

Q8BQM8

Predicted Effect

probably benign
Transcript: ENSMUST00000065716
AA Change: D1349E

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: D1349E

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000222128
AA Change: D178E

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223282
AA Change: D1396E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam39	C	T	8: 40,824,650	T26I	probably benign	Het
Adgrg7	A	G	16: 56,750,450	L405P	probably damaging	Het
AI314180	G	A	4: 58,832,796	R855*	probably null	Het
Ankle1	A	G	8: 71,406,780	D106G	probably damaging	Het
Ankrd17	G	T	5: 90,253,677	D1609E		Het
Anpep	A	G	7: 79,826,913	V772A	probably benign	Het
Anxa8	T	C	14: 34,092,552	V115A	possibly damaging	Het
Aoc1	T	C	6: 48,905,838	F216S	probably damaging	Het
Aplf	T	A	6: 87,663,799	E76V	possibly damaging	Het
Apol11b	C	T	15: 77,640,571	E5K	possibly damaging	Het
Arhgap42	T	A	9: 9,148,208	Y120F		Het
Atg2a	T	A	19: 6,255,719	H1316Q	probably benign	Het
Atp8b3	A	G	10: 80,525,988	F743S	probably benign	Het
Best1	A	T	19: 9,992,967	W94R	probably damaging	Het
Catsper3	T	C	13: 55,805,856		probably null	Het
Ccdc80	A	T	16: 45,095,086	E68D	probably benign	Het
Col8a1	T	A	16: 57,628,176	I324F	unknown	Het
Coro1c	G	A	5: 113,865,755	R68*	probably null	Het
Dennd4c	A	G	4: 86,828,971	D1464G	possibly damaging	Het
Dgat2	C	T	7: 99,169,719	V77I	possibly damaging	Het
Ednra	A	C	8: 77,667,332	N378K	possibly damaging	Het
Ethe1	G	T	7: 24,593,811		probably benign	Het
Fgf21	C	T	7: 45,615,170	R46Q	probably damaging	Het
Flt3	C	T	5: 147,372,614	V198M	possibly damaging	Het
Fryl	T	C	5: 73,022,155	N2970D	probably benign	Het
Gm2022	A	G	12: 87,895,764	D132G	unknown	Het
Gtf2e2	T	A	8: 33,762,048	D197E	probably damaging	Het
Gtf2i	G	A	5: 134,265,773	R362W	probably damaging	Het
Gtpbp10	C	T	5: 5,546,382	G188R	probably damaging	Het
Gzmc	A	C	14: 56,231,585	S226A	probably benign	Het
Hhatl	A	T	9: 121,784,216	V471D	possibly damaging	Het
Hoxd11	T	C	2: 74,682,468	S26P	possibly damaging	Het
Ighv1-85	A	T	12: 116,000,174	W69R	probably benign	Het
Kcnk3	T	C	5: 30,622,089	L161P	possibly damaging	Het
Klk6	A	G	7: 43,828,543	D113G	probably damaging	Het
Map3k5	A	G	10: 20,000,568	I158V	probably benign	Het
March8	T	A	6: 116,405,678	M434K	probably benign	Het
Mcc	T	C	18: 44,445,858	R828G	probably damaging	Het
Muc4	A	T	16: 32,750,877	T252S	possibly damaging	Het
Naip5	T	C	13: 100,223,313	T472A	probably benign	Het
Nme7	A	G	1: 164,379,392	D282G	probably benign	Het
Npdc1	G	T	2: 25,408,300	A228S	probably benign	Het
Nrbp1	T	A	5: 31,243,928	S49R	probably damaging	Het
Ntan1	T	C	16: 13,819,384	V10A	possibly damaging	Het
Olfr1358	T	C	10: 78,520,250	V214A	probably benign	Het
Olfr518	A	G	7: 108,881,297	V103A	possibly damaging	Het
Olfr66	A	G	7: 103,881,649	V198A	probably benign	Het
Pdcd2l	T	C	7: 34,192,976	D156G	probably benign	Het
Pde11a	A	G	2: 76,046,813	S771P	probably damaging	Het
Pilra	T	A	5: 137,836,080	M14L	probably benign	Het
Pkd1l1	T	A	11: 8,890,697	E1237V		Het
Pkp2	A	T	16: 16,260,414	T507S	possibly damaging	Het
Polm	A	G	11: 5,829,713	Y362H	probably damaging	Het
Pramef8	A	T	4: 143,417,944	M287L	probably benign	Het
Prcd	C	T	11: 116,659,757	S85F	possibly damaging	Het
Prox2	G	A	12: 85,094,992	Q146*	probably null	Het
Ptger1	T	C	8: 83,668,832	W313R	probably damaging	Het
Ptpn23	T	C	9: 110,398,149	E44G	probably damaging	Het
Rai1	A	G	11: 60,185,742	T211A	probably benign	Het
Rgl1	C	A	1: 152,554,331	D234Y	possibly damaging	Het
Rlf	A	G	4: 121,149,890	V741A	possibly damaging	Het
Rnaseh2b	T	C	14: 62,360,529		probably null	Het
Selenon	C	T	4: 134,542,744	R383H	probably benign	Het
Sh3rf2	A	T	18: 42,139,555	H368L	possibly damaging	Het
Slc9c1	A	T	16: 45,560,342	I544L	probably benign	Het
Smarca4	A	G	9: 21,669,553	E993G	probably damaging	Het
Stab1	T	A	14: 31,142,681	I1966F	probably benign	Het
Stard9	G	A	2: 120,704,233	S3657N	probably benign	Het
Tex15	G	A	8: 33,577,281	M2246I	probably damaging	Het
Ttc41	A	T	10: 86,713,734	N264I	possibly damaging	Het
Use1	T	A	8: 71,367,829	M96K	possibly damaging	Het
Vmn1r201	T	C	13: 22,475,066	I150T	probably damaging	Het
Vmn1r34	T	C	6: 66,637,734	I7V	probably benign	Het
Vps8	T	A	16: 21,644,203	F1406Y	probably benign	Het
Zfp788	A	T	7: 41,650,582	T881S	possibly damaging	Het
Zfp804a	C	T	2: 82,258,500	T891I	probably benign	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB010:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8111:Eml5	UTSW	12	98792514	critical splice donor site	probably null
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
R8482:Eml5	UTSW	12	98876301	missense	probably damaging	1.00
R8732:Eml5	UTSW	12	98815959	missense	probably damaging	0.99
R8956:Eml5	UTSW	12	98852693	missense	possibly damaging	0.69
R8975:Eml5	UTSW	12	98810570	missense	probably damaging	0.99
R9131:Eml5	UTSW	12	98858840	missense	probably damaging	1.00
R9258:Eml5	UTSW	12	98844117	missense	possibly damaging	0.77
R9261:Eml5	UTSW	12	98856028	missense	probably damaging	0.99
R9276:Eml5	UTSW	12	98798801	missense	probably damaging	0.99
R9301:Eml5	UTSW	12	98882033	nonsense	probably null
R9368:Eml5	UTSW	12	98796578	missense	probably benign	0.31
R9392:Eml5	UTSW	12	98900940	missense	probably damaging	1.00
R9393:Eml5	UTSW	12	98876174	missense	probably benign	0.35
R9449:Eml5	UTSW	12	98861295	missense	probably damaging	1.00
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGACCCTGTCTTGAAAACAAAC -3'
(R):5'- ACTTTTGGGGAAGAAGAGGTTC -3'

Sequencing Primer
(F):5'- GACCCTGTCTTGAAAACAAACCAAAC -3'
(R):5'- TTTGGGGAAGAAGAGGTTCAGTGG -3'

Posted On

2022-08-09