Incidental Mutation 'R9570:Slc9c1'
ID 721952
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.458) question?
Stock # R9570 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 45380705 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 544 (I544L)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect probably benign
Transcript: ENSMUST00000159945
AA Change: I544L

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: I544L

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 C T 8: 41,277,687 (GRCm39) T26I probably benign Het
Adgrg7 A G 16: 56,570,813 (GRCm39) L405P probably damaging Het
Ankle1 A G 8: 71,859,424 (GRCm39) D106G probably damaging Het
Ankrd17 G T 5: 90,401,536 (GRCm39) D1609E Het
Anpep A G 7: 79,476,661 (GRCm39) V772A probably benign Het
Anxa8 T C 14: 33,814,509 (GRCm39) V115A possibly damaging Het
Aoc1 T C 6: 48,882,772 (GRCm39) F216S probably damaging Het
Aplf T A 6: 87,640,781 (GRCm39) E76V possibly damaging Het
Apol11b C T 15: 77,524,771 (GRCm39) E5K possibly damaging Het
Arhgap42 T A 9: 9,148,209 (GRCm39) Y120F Het
Atg2a T A 19: 6,305,749 (GRCm39) H1316Q probably benign Het
Atp8b3 A G 10: 80,361,822 (GRCm39) F743S probably benign Het
Best1 A T 19: 9,970,331 (GRCm39) W94R probably damaging Het
Catsper3 T C 13: 55,953,669 (GRCm39) probably null Het
Ccdc80 A T 16: 44,915,449 (GRCm39) E68D probably benign Het
Col8a1 T A 16: 57,448,539 (GRCm39) I324F unknown Het
Coro1c G A 5: 114,003,816 (GRCm39) R68* probably null Het
Dennd4c A G 4: 86,747,208 (GRCm39) D1464G possibly damaging Het
Dgat2 C T 7: 98,818,926 (GRCm39) V77I possibly damaging Het
Ecpas G A 4: 58,832,796 (GRCm39) R855* probably null Het
Ednra A C 8: 78,393,961 (GRCm39) N378K possibly damaging Het
Eif1ad4 A G 12: 87,862,534 (GRCm39) D132G unknown Het
Eml5 A T 12: 98,782,243 (GRCm39) D178E probably benign Het
Ethe1 G T 7: 24,293,236 (GRCm39) probably benign Het
Fgf21 C T 7: 45,264,594 (GRCm39) R46Q probably damaging Het
Flt3 C T 5: 147,309,424 (GRCm39) V198M possibly damaging Het
Fryl T C 5: 73,179,498 (GRCm39) N2970D probably benign Het
Gtf2e2 T A 8: 34,252,076 (GRCm39) D197E probably damaging Het
Gtf2i G A 5: 134,294,627 (GRCm39) R362W probably damaging Het
Gtpbp10 C T 5: 5,596,382 (GRCm39) G188R probably damaging Het
Gzmc A C 14: 56,469,042 (GRCm39) S226A probably benign Het
Hhatl A T 9: 121,613,282 (GRCm39) V471D possibly damaging Het
Hoxd11 T C 2: 74,512,812 (GRCm39) S26P possibly damaging Het
Ighv1-85 A T 12: 115,963,794 (GRCm39) W69R probably benign Het
Kcnk3 T C 5: 30,779,433 (GRCm39) L161P possibly damaging Het
Klk6 A G 7: 43,477,967 (GRCm39) D113G probably damaging Het
Map3k5 A G 10: 19,876,314 (GRCm39) I158V probably benign Het
Marchf8 T A 6: 116,382,639 (GRCm39) M434K probably benign Het
Mcc T C 18: 44,578,925 (GRCm39) R828G probably damaging Het
Muc4 A T 16: 32,569,695 (GRCm39) T252S possibly damaging Het
Naip5 T C 13: 100,359,821 (GRCm39) T472A probably benign Het
Nme7 A G 1: 164,206,961 (GRCm39) D282G probably benign Het
Npdc1 G T 2: 25,298,312 (GRCm39) A228S probably benign Het
Nrbp1 T A 5: 31,401,272 (GRCm39) S49R probably damaging Het
Ntan1 T C 16: 13,637,248 (GRCm39) V10A possibly damaging Het
Or10a3 A G 7: 108,480,504 (GRCm39) V103A possibly damaging Het
Or10b1 T C 10: 78,356,084 (GRCm39) V214A probably benign Het
Or51b4 A G 7: 103,530,856 (GRCm39) V198A probably benign Het
Pdcd2l T C 7: 33,892,401 (GRCm39) D156G probably benign Het
Pde11a A G 2: 75,877,157 (GRCm39) S771P probably damaging Het
Pilra T A 5: 137,834,342 (GRCm39) M14L probably benign Het
Pkd1l1 T A 11: 8,840,697 (GRCm39) E1237V Het
Pkp2 A T 16: 16,078,278 (GRCm39) T507S possibly damaging Het
Polm A G 11: 5,779,713 (GRCm39) Y362H probably damaging Het
Pramel12 A T 4: 143,144,514 (GRCm39) M287L probably benign Het
Prcd C T 11: 116,550,583 (GRCm39) S85F possibly damaging Het
Prox2 G A 12: 85,141,766 (GRCm39) Q146* probably null Het
Ptger1 T C 8: 84,395,461 (GRCm39) W313R probably damaging Het
Ptpn23 T C 9: 110,227,217 (GRCm39) E44G probably damaging Het
Rai1 A G 11: 60,076,568 (GRCm39) T211A probably benign Het
Rgl1 C A 1: 152,430,082 (GRCm39) D234Y possibly damaging Het
Rlf A G 4: 121,007,087 (GRCm39) V741A possibly damaging Het
Rnaseh2b T C 14: 62,597,978 (GRCm39) probably null Het
Selenon C T 4: 134,270,055 (GRCm39) R383H probably benign Het
Sh3rf2 A T 18: 42,272,620 (GRCm39) H368L possibly damaging Het
Smarca4 A G 9: 21,580,849 (GRCm39) E993G probably damaging Het
Stab1 T A 14: 30,864,638 (GRCm39) I1966F probably benign Het
Stard9 G A 2: 120,534,714 (GRCm39) S3657N probably benign Het
Tex15 G A 8: 34,067,309 (GRCm39) M2246I probably damaging Het
Ttc41 A T 10: 86,549,598 (GRCm39) N264I possibly damaging Het
Use1 T A 8: 71,820,473 (GRCm39) M96K possibly damaging Het
Vmn1r201 T C 13: 22,659,236 (GRCm39) I150T probably damaging Het
Vmn1r34 T C 6: 66,614,718 (GRCm39) I7V probably benign Het
Vps8 T A 16: 21,462,953 (GRCm39) F1406Y probably benign Het
Zfp788 A T 7: 41,300,006 (GRCm39) T881S possibly damaging Het
Zfp804a C T 2: 82,088,844 (GRCm39) T891I probably benign Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45,427,219 (GRCm39) utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45,393,719 (GRCm39) missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45,363,483 (GRCm39) splice site probably benign
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45,373,291 (GRCm39) missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45,365,099 (GRCm39) missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45,400,582 (GRCm39) missense probably benign
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45,419,829 (GRCm39) missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45,376,977 (GRCm39) missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45,376,132 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45,370,479 (GRCm39) missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45,401,878 (GRCm39) missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45,413,734 (GRCm39) missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45,427,182 (GRCm39) missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45,380,646 (GRCm39) missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45,400,490 (GRCm39) missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45,398,275 (GRCm39) missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45,413,848 (GRCm39) missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9686:Slc9c1 UTSW 16 45,400,577 (GRCm39) missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45,368,026 (GRCm39) missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45,400,616 (GRCm39) missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGCCAGATTCTGTTATTTCCCAA -3'
(R):5'- CACCCAGTGTTTCTCTTTCTGAA -3'

Sequencing Primer
(F):5'- GTTATTTCCCAAAACAACTAGTGTG -3'
(R):5'- TGAATTCCCCCAATGCTGG -3'
Posted On 2022-08-09