Incidental Mutation 'R9571:Ddx31'
ID 721964
Institutional Source Beutler Lab
Gene Symbol Ddx31
Ensembl Gene ENSMUSG00000026806
Gene Name DEAD/H box helicase 31
Synonyms 5830444G11Rik, DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.855) question?
Stock # R9571 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 28730418-28795583 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 28750034 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 352 (V352D)
Ref Sequence ENSEMBL: ENSMUSP00000109484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113853]
AlphaFold Q6NZQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000113853
AA Change: V352D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109484
Gene: ENSMUSG00000026806
AA Change: V352D

DomainStartEndE-ValueType
DEXDc 123 332 2.28e-48 SMART
HELICc 408 487 4.02e-26 SMART
DUF4217 556 621 6.21e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020A23Rik A G 2: 130,247,482 (GRCm39) D6G probably benign Het
Abl2 T G 1: 156,469,084 (GRCm39) S783A probably damaging Het
Adamtsl1 A T 4: 86,117,543 (GRCm39) T169S probably benign Het
Adcy9 A G 16: 4,141,653 (GRCm39) V621A probably benign Het
Ahnak2 T C 12: 112,742,510 (GRCm39) S521G possibly damaging Het
Ap2m1 G A 16: 20,360,037 (GRCm39) G213R probably damaging Het
Apol11b C T 15: 77,524,771 (GRCm39) E5K possibly damaging Het
Arl4d T C 11: 101,558,032 (GRCm39) M186T possibly damaging Het
Cep192 A G 18: 67,952,109 (GRCm39) D428G probably damaging Het
Ckap5 A C 2: 91,387,953 (GRCm39) D266A probably damaging Het
Crls1 A T 2: 132,691,793 (GRCm39) N106I probably damaging Het
Csmd3 T A 15: 48,655,398 (GRCm39) probably benign Het
Csnk1a1 A G 18: 61,704,969 (GRCm39) R161G possibly damaging Het
Cyp4f39 T A 17: 32,702,196 (GRCm39) I231N probably damaging Het
Dna2 A G 10: 62,800,740 (GRCm39) D758G probably damaging Het
Duxf4 G A 10: 58,071,378 (GRCm39) L279F possibly damaging Het
Gatad2a C A 8: 70,370,381 (GRCm39) A172S probably benign Het
Ghsr G T 3: 27,426,664 (GRCm39) R240L probably benign Het
Gli3 T A 13: 15,900,858 (GRCm39) M1415K probably benign Het
Glo1 G A 17: 30,816,835 (GRCm39) T107I possibly damaging Het
Gm10800 AAAGAAAACTGAA ACAAGAAAACTGAA 2: 98,497,378 (GRCm39) probably null Het
Gm17334 C T 11: 53,663,760 (GRCm39) V34M unknown Het
Habp4 T A 13: 64,322,615 (GRCm39) M228K probably benign Het
Hacl1 A G 14: 31,344,838 (GRCm39) V257A possibly damaging Het
Ift122 T G 6: 115,857,628 (GRCm39) S125A possibly damaging Het
Iqce C T 5: 140,651,862 (GRCm39) D704N possibly damaging Het
Jcad T A 18: 4,673,252 (GRCm39) L338* probably null Het
Kcnj13 T C 1: 87,316,849 (GRCm39) D88G probably damaging Het
Kif1b T C 4: 149,305,098 (GRCm39) D942G probably damaging Het
Marchf8 T A 6: 116,383,237 (GRCm39) S271T probably benign Het
Meis1 A G 11: 18,961,378 (GRCm39) L165S probably damaging Het
Morc2b T A 17: 33,355,178 (GRCm39) T865S probably benign Het
Morc3 T A 16: 93,641,107 (GRCm39) N46K possibly damaging Het
Mpzl1 C T 1: 165,429,374 (GRCm39) C219Y probably benign Het
Mup5 A G 4: 61,750,787 (GRCm39) probably null Het
Ninl A T 2: 150,791,803 (GRCm39) W907R probably benign Het
Nol6 A T 4: 41,120,156 (GRCm39) S491T probably benign Het
Or4f53 A T 2: 111,088,083 (GRCm39) I208F probably benign Het
Or51g1 A G 7: 102,634,221 (GRCm39) V50A probably benign Het
Or5b121 T A 19: 13,507,697 (GRCm39) I264N probably damaging Het
Or6c205 C A 10: 129,087,182 (GRCm39) P260T possibly damaging Het
Osbpl6 T A 2: 76,425,191 (GRCm39) M919K probably benign Het
Otogl A T 10: 107,598,364 (GRCm39) V2262E possibly damaging Het
Pcbp2 A G 15: 102,383,113 (GRCm39) D77G possibly damaging Het
Pcsk7 G A 9: 45,820,907 (GRCm39) R113Q possibly damaging Het
Pds5b T C 5: 150,645,971 (GRCm39) I143T probably damaging Het
Polr2m T C 9: 71,386,710 (GRCm39) E357G possibly damaging Het
Prox2 G A 12: 85,141,766 (GRCm39) Q146* probably null Het
Ptprt A G 2: 161,395,732 (GRCm39) V1167A probably benign Het
Rbm11 G A 16: 75,397,543 (GRCm39) E158K possibly damaging Het
Sall2 A T 14: 52,551,830 (GRCm39) V455E probably damaging Het
Sar1b T A 11: 51,680,064 (GRCm39) L130Q probably damaging Het
Slc35f6 A G 5: 30,815,180 (GRCm39) N369S possibly damaging Het
Slc39a12 A T 2: 14,412,380 (GRCm39) M351L probably benign Het
Taf15 T A 11: 83,395,487 (GRCm39) Y397* probably null Het
Tmprss11e A T 5: 86,875,149 (GRCm39) V39D probably damaging Het
Trim71 T C 9: 114,342,359 (GRCm39) D641G probably damaging Het
Trpc3 T A 3: 36,694,909 (GRCm39) T682S probably damaging Het
Tsen54 T C 11: 115,707,933 (GRCm39) probably null Het
Usp6nl A G 2: 6,445,960 (GRCm39) N646D possibly damaging Het
Vip T C 10: 5,590,661 (GRCm39) F12L probably benign Het
Vmn1r39 A T 6: 66,781,572 (GRCm39) F249I probably benign Het
Vmn2r106 A T 17: 20,505,641 (GRCm39) S18T probably benign Het
Vmn2r97 G T 17: 19,149,919 (GRCm39) V436L probably benign Het
Washc2 T C 6: 116,237,631 (GRCm39) probably null Het
Ykt6 T C 11: 5,914,613 (GRCm39) V171A possibly damaging Het
Zfp658 A G 7: 43,222,139 (GRCm39) D138G possibly damaging Het
Other mutations in Ddx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01664:Ddx31 APN 2 28,765,847 (GRCm39) splice site probably benign
IGL01918:Ddx31 APN 2 28,764,176 (GRCm39) missense probably damaging 1.00
IGL02174:Ddx31 APN 2 28,749,041 (GRCm39) missense probably damaging 1.00
IGL02560:Ddx31 APN 2 28,765,838 (GRCm39) missense probably damaging 1.00
IGL02938:Ddx31 APN 2 28,749,035 (GRCm39) missense possibly damaging 0.49
R0241:Ddx31 UTSW 2 28,738,303 (GRCm39) missense probably damaging 1.00
R0241:Ddx31 UTSW 2 28,738,303 (GRCm39) missense probably damaging 1.00
R0440:Ddx31 UTSW 2 28,747,144 (GRCm39) missense probably damaging 1.00
R0701:Ddx31 UTSW 2 28,748,789 (GRCm39) missense probably null 1.00
R0729:Ddx31 UTSW 2 28,764,186 (GRCm39) missense probably damaging 1.00
R1227:Ddx31 UTSW 2 28,747,187 (GRCm39) missense probably damaging 1.00
R1532:Ddx31 UTSW 2 28,771,171 (GRCm39) missense probably benign 0.00
R1608:Ddx31 UTSW 2 28,749,078 (GRCm39) missense probably damaging 0.97
R1646:Ddx31 UTSW 2 28,782,532 (GRCm39) missense probably benign
R1674:Ddx31 UTSW 2 28,748,828 (GRCm39) missense probably damaging 1.00
R1834:Ddx31 UTSW 2 28,782,465 (GRCm39) missense probably damaging 1.00
R1884:Ddx31 UTSW 2 28,749,002 (GRCm39) missense probably damaging 0.97
R4133:Ddx31 UTSW 2 28,748,864 (GRCm39) missense probably damaging 1.00
R4911:Ddx31 UTSW 2 28,794,696 (GRCm39) missense probably benign 0.00
R4972:Ddx31 UTSW 2 28,750,782 (GRCm39) missense probably damaging 1.00
R5240:Ddx31 UTSW 2 28,736,042 (GRCm39) missense probably benign 0.03
R5358:Ddx31 UTSW 2 28,753,782 (GRCm39) missense probably damaging 0.98
R5450:Ddx31 UTSW 2 28,776,981 (GRCm39) missense probably damaging 0.97
R5945:Ddx31 UTSW 2 28,749,902 (GRCm39) missense probably damaging 1.00
R5956:Ddx31 UTSW 2 28,764,185 (GRCm39) missense probably damaging 1.00
R6235:Ddx31 UTSW 2 28,734,854 (GRCm39) missense probably benign 0.00
R6245:Ddx31 UTSW 2 28,734,994 (GRCm39) missense probably benign 0.00
R6463:Ddx31 UTSW 2 28,737,525 (GRCm39) critical splice donor site probably null
R6647:Ddx31 UTSW 2 28,765,750 (GRCm39) missense probably damaging 1.00
R6783:Ddx31 UTSW 2 28,764,188 (GRCm39) missense probably benign 0.26
R6917:Ddx31 UTSW 2 28,782,421 (GRCm39) missense probably damaging 1.00
R7135:Ddx31 UTSW 2 28,738,318 (GRCm39) missense probably benign
R7819:Ddx31 UTSW 2 28,782,463 (GRCm39) missense probably damaging 1.00
R8812:Ddx31 UTSW 2 28,730,816 (GRCm39) unclassified probably benign
R9122:Ddx31 UTSW 2 28,748,753 (GRCm39) missense probably damaging 1.00
R9326:Ddx31 UTSW 2 28,749,008 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGGTGTATATGTGACCACCC -3'
(R):5'- CATAATCATGCATGCACGCAGG -3'

Sequencing Primer
(F):5'- GGTGTAACACGGCTAGTT -3'
(R):5'- AGGCACTCGCTTACCCATG -3'
Posted On 2022-08-09