Incidental Mutation 'R9571:Gli3'
ID 722007
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene Name GLI-Kruppel family member GLI3
Synonyms brachyphalangy, Bph
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9571 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 15463235-15730026 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 15726273 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1415 (M1415K)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510]
AlphaFold Q61602
Predicted Effect probably benign
Transcript: ENSMUST00000110510
AA Change: M1415K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: M1415K

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020A23Rik A G 2: 130,405,562 D6G probably benign Het
Abl2 T G 1: 156,641,514 S783A probably damaging Het
Adamtsl1 A T 4: 86,199,306 T169S probably benign Het
Adcy9 A G 16: 4,323,789 V621A probably benign Het
Ahnak2 T C 12: 112,776,076 S521G possibly damaging Het
Ap2m1 G A 16: 20,541,287 G213R probably damaging Het
Apol11b C T 15: 77,640,571 E5K possibly damaging Het
Arl4d T C 11: 101,667,206 M186T possibly damaging Het
Cep192 A G 18: 67,819,038 D428G probably damaging Het
Ckap5 A C 2: 91,557,608 D266A probably damaging Het
Crls1 A T 2: 132,849,873 N106I probably damaging Het
Csmd3 T A 15: 48,792,002 probably benign Het
Csnk1a1 A G 18: 61,571,898 R161G possibly damaging Het
Cyp4f39 T A 17: 32,483,222 I231N probably damaging Het
Ddx31 T A 2: 28,860,022 V352D probably damaging Het
Dna2 A G 10: 62,964,961 D758G probably damaging Het
Gatad2a C A 8: 69,917,731 A172S probably benign Het
Ghsr G T 3: 27,372,515 R240L probably benign Het
Glo1 G A 17: 30,597,861 T107I possibly damaging Het
Gm10800 AAAGAAAACTGAA ACAAGAAAACTGAA 2: 98,667,033 probably null Het
Gm17334 C T 11: 53,772,934 V34M unknown Het
Gm4981 G A 10: 58,235,556 L279F possibly damaging Het
Habp4 T A 13: 64,174,801 M228K probably benign Het
Hacl1 A G 14: 31,622,881 V257A possibly damaging Het
Ift122 T G 6: 115,880,667 S125A possibly damaging Het
Iqce C T 5: 140,666,107 D704N possibly damaging Het
Jcad T A 18: 4,673,252 L338* probably null Het
Kcnj13 T C 1: 87,389,127 D88G probably damaging Het
Kif1b T C 4: 149,220,641 D942G probably damaging Het
March8 T A 6: 116,406,276 S271T probably benign Het
Meis1 A G 11: 19,011,378 L165S probably damaging Het
Morc2b T A 17: 33,136,204 T865S probably benign Het
Morc3 T A 16: 93,844,219 N46K possibly damaging Het
Mpzl1 C T 1: 165,601,805 C219Y probably benign Het
Mup5 A G 4: 61,832,550 probably null Het
Ninl A T 2: 150,949,883 W907R probably benign Het
Nol6 A T 4: 41,120,156 S491T probably benign Het
Olfr1276 A T 2: 111,257,738 I208F probably benign Het
Olfr1480 T A 19: 13,530,333 I264N probably damaging Het
Olfr578 A G 7: 102,985,014 V50A probably benign Het
Olfr775 C A 10: 129,251,313 P260T possibly damaging Het
Osbpl6 T A 2: 76,594,847 M919K probably benign Het
Otogl A T 10: 107,762,503 V2262E possibly damaging Het
Pcbp2 A G 15: 102,474,678 D77G possibly damaging Het
Pcsk7 G A 9: 45,909,609 R113Q possibly damaging Het
Pds5b T C 5: 150,722,506 I143T probably damaging Het
Polr2m T C 9: 71,479,428 E357G possibly damaging Het
Prox2 G A 12: 85,094,992 Q146* probably null Het
Ptprt A G 2: 161,553,812 V1167A probably benign Het
Rbm11 G A 16: 75,600,655 E158K possibly damaging Het
Sall2 A T 14: 52,314,373 V455E probably damaging Het
Sar1b T A 11: 51,789,237 L130Q probably damaging Het
Slc35f6 A G 5: 30,657,836 N369S possibly damaging Het
Slc39a12 A T 2: 14,407,569 M351L probably benign Het
Taf15 T A 11: 83,504,661 Y397* probably null Het
Tmprss11e A T 5: 86,727,290 V39D probably damaging Het
Trim71 T C 9: 114,513,291 D641G probably damaging Het
Trpc3 T A 3: 36,640,760 T682S probably damaging Het
Tsen54 T C 11: 115,817,107 probably null Het
Usp6nl A G 2: 6,441,149 N646D possibly damaging Het
Vip T C 10: 5,640,661 F12L probably benign Het
Vmn1r39 A T 6: 66,804,588 F249I probably benign Het
Vmn2r106 A T 17: 20,285,379 S18T probably benign Het
Vmn2r97 G T 17: 18,929,657 V436L probably benign Het
Washc2 T C 6: 116,260,670 probably null Het
Ykt6 T C 11: 5,964,613 V171A possibly damaging Het
Zfp658 A G 7: 43,572,715 D138G possibly damaging Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15644299 missense probably damaging 1.00
IGL00471:Gli3 APN 13 15723769 critical splice donor site probably null
IGL00484:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15548398 critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15648634 missense probably damaging 1.00
IGL01799:Gli3 APN 13 15726161 missense probably benign 0.00
IGL01861:Gli3 APN 13 15725325 missense probably damaging 1.00
IGL02063:Gli3 APN 13 15726372 missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15662514 missense probably damaging 1.00
IGL02255:Gli3 APN 13 15648719 missense probably damaging 1.00
IGL02270:Gli3 APN 13 15726786 utr 3 prime probably benign
IGL02336:Gli3 APN 13 15720289 missense probably damaging 1.00
IGL02346:Gli3 APN 13 15723693 missense probably damaging 1.00
IGL02744:Gli3 APN 13 15613886 critical splice donor site probably null
IGL02877:Gli3 APN 13 15724742 missense probably damaging 1.00
IGL02975:Gli3 APN 13 15724568 missense probably damaging 1.00
IGL03018:Gli3 APN 13 15660132 missense probably damaging 1.00
IGL03378:Gli3 APN 13 15644420 missense probably damaging 1.00
IGL03406:Gli3 APN 13 15648581 missense probably damaging 1.00
Capone UTSW 13 15715034 missense probably damaging 1.00
Carpals UTSW 13 15713650 critical splice donor site probably null
Ness UTSW 13 15723555 missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15644357 missense probably damaging 1.00
R0110:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0329:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0330:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0360:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0364:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0469:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0616:Gli3 UTSW 13 15662406 missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15724715 missense probably damaging 1.00
R1072:Gli3 UTSW 13 15713605 missense probably damaging 1.00
R1257:Gli3 UTSW 13 15725996 nonsense probably null
R1270:Gli3 UTSW 13 15723744 missense probably benign 0.02
R1424:Gli3 UTSW 13 15726314 missense probably benign 0.00
R1481:Gli3 UTSW 13 15613850 missense probably damaging 0.99
R1596:Gli3 UTSW 13 15725471 missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15726312 missense probably benign 0.00
R1721:Gli3 UTSW 13 15726297 missense probably benign 0.27
R1797:Gli3 UTSW 13 15713512 missense probably damaging 0.99
R1813:Gli3 UTSW 13 15648691 missense probably damaging 1.00
R1819:Gli3 UTSW 13 15725792 nonsense probably null
R1988:Gli3 UTSW 13 15726380 missense probably benign
R2132:Gli3 UTSW 13 15725549 missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15662392 missense probably benign 0.02
R3085:Gli3 UTSW 13 15660941 missense probably damaging 1.00
R3177:Gli3 UTSW 13 15725982 missense probably benign 0.28
R3277:Gli3 UTSW 13 15725982 missense probably benign 0.28
R4162:Gli3 UTSW 13 15725115 missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15723571 missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15713631 missense probably damaging 1.00
R4979:Gli3 UTSW 13 15724464 missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15548507 missense probably damaging 0.99
R5395:Gli3 UTSW 13 15714950 missense probably damaging 1.00
R5494:Gli3 UTSW 13 15725982 missense probably benign 0.28
R5609:Gli3 UTSW 13 15548453 missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15478165 critical splice donor site probably null
R5810:Gli3 UTSW 13 15644309 missense probably damaging 0.99
R5896:Gli3 UTSW 13 15726180 missense probably benign 0.00
R5930:Gli3 UTSW 13 15548625 missense probably damaging 1.00
R5964:Gli3 UTSW 13 15726162 nonsense probably null
R5985:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6224:Gli3 UTSW 13 15725145 missense probably benign
R6278:Gli3 UTSW 13 15725113 missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15724732 missense probably damaging 1.00
R6383:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6523:Gli3 UTSW 13 15713650 critical splice donor site probably null
R7072:Gli3 UTSW 13 15725695 missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15715062 missense probably damaging 1.00
R7228:Gli3 UTSW 13 15724502 missense probably benign 0.00
R7327:Gli3 UTSW 13 15725559 missense probably benign 0.02
R7451:Gli3 UTSW 13 15726291 missense possibly damaging 0.50
R7974:Gli3 UTSW 13 15726256 missense probably benign 0.00
R8167:Gli3 UTSW 13 15725643 missense probably benign 0.00
R8170:Gli3 UTSW 13 15720208 missense probably benign
R8199:Gli3 UTSW 13 15725991 missense probably benign 0.08
R8247:Gli3 UTSW 13 15726775 missense possibly damaging 0.82
R8332:Gli3 UTSW 13 15713548 missense possibly damaging 0.58
R8347:Gli3 UTSW 13 15723525 missense probably damaging 1.00
R8559:Gli3 UTSW 13 15660132 missense probably damaging 1.00
R8676:Gli3 UTSW 13 15715034 missense probably damaging 1.00
R8905:Gli3 UTSW 13 15726531 missense probably benign 0.01
R9099:Gli3 UTSW 13 15726735 missense probably damaging 1.00
R9260:Gli3 UTSW 13 15725090 missense probably damaging 0.99
R9317:Gli3 UTSW 13 15715073 missense probably damaging 1.00
R9475:Gli3 UTSW 13 15725711 missense possibly damaging 0.87
R9546:Gli3 UTSW 13 15613858 missense probably benign 0.00
R9621:Gli3 UTSW 13 15726668 missense probably benign 0.01
R9704:Gli3 UTSW 13 15723473 missense probably damaging 1.00
R9787:Gli3 UTSW 13 15725801 missense probably damaging 0.96
RF010:Gli3 UTSW 13 15726369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACAGGTACTAGGGCAGGTTG -3'
(R):5'- TTTCAGTGCCATTCCCTTGGAG -3'

Sequencing Primer
(F):5'- GGTTGGTGCTACCTCACATATCAAC -3'
(R):5'- ATTCCCTTGGAGCAGGCAG -3'
Posted On 2022-08-09