Incidental Mutation 'R9573:Wdr35'
ID 722126
Institutional Source Beutler Lab
Gene Symbol Wdr35
Ensembl Gene ENSMUSG00000066643
Gene Name WD repeat domain 35
Synonyms 4930459M12Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9573 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 8973892-9028847 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 9028014 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 1135 (G1135D)
Ref Sequence ENSEMBL: ENSMUSP00000082895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085741] [ENSMUST00000085745] [ENSMUST00000111113] [ENSMUST00000219470] [ENSMUST00000219488]
AlphaFold Q8BND3
Predicted Effect probably benign
Transcript: ENSMUST00000085741
SMART Domains Protein: ENSMUSP00000082891
Gene: ENSMUSG00000066637

DomainStartEndE-ValueType
Pfam:TPR_9 12 58 1.2e-2 PFAM
Pfam:TPR_12 51 121 1e-9 PFAM
Pfam:TPR_11 53 120 1.2e-14 PFAM
Pfam:TPR_1 55 88 3.5e-6 PFAM
Pfam:TPR_9 70 134 4.9e-7 PFAM
Pfam:TPR_1 90 122 1e-10 PFAM
Pfam:TPR_2 91 122 8.3e-11 PFAM
Pfam:TPR_8 91 122 2.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085745
AA Change: G1135D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000082895
Gene: ENSMUSG00000066643
AA Change: G1135D

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 465 530 4e-15 BLAST
Blast:WD40 533 571 1e-14 BLAST
low complexity region 1069 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111113
AA Change: G1124D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106742
Gene: ENSMUSG00000066643
AA Change: G1124D

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 454 519 4e-15 BLAST
Blast:WD40 522 560 2e-14 BLAST
low complexity region 1058 1067 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219470
Predicted Effect probably benign
Transcript: ENSMUST00000219488
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Two patients with Sensenbrenner syndrome / cranioectodermal dysplasia (CED) were identified with mutations in this gene, consistent with a possible ciliary function.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit mid-gestation lethality, heart development defects, turning defects, polysyndactyly, hypoplastic lungs, tracheoesophageal fistula, herniated diaphragm and absent embryonic cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,465,778 I548N probably damaging Het
Afdn T A 17: 13,829,967 V472E probably damaging Het
Ak3 T C 19: 29,026,267 I170V probably benign Het
Ank3 T A 10: 69,956,147 L1058* probably null Het
Ankrd60 A G 2: 173,568,998 V243A possibly damaging Het
Apol11b C T 15: 77,640,571 E5K possibly damaging Het
Arid3c T G 4: 41,726,003 E200A probably benign Het
Astn2 T G 4: 65,648,354 I856L probably benign Het
Bcs1l C A 1: 74,590,333 R177S probably damaging Het
Bin2 A T 15: 100,662,552 F43I probably damaging Het
Braf A G 6: 39,623,610 L691P probably damaging Het
Bud23 C T 5: 135,053,420 V266I possibly damaging Het
Casp12 A T 9: 5,354,629 I333L probably benign Het
Cavin2 T A 1: 51,289,636 I84N probably damaging Het
Cep170b T A 12: 112,724,720 F24I probably damaging Het
Chd9 A G 8: 90,977,674 Y719C unknown Het
Commd7 A G 2: 153,622,061 M137T probably damaging Het
Dmbt1 G A 7: 131,056,180 probably null Het
Dnah12 A C 14: 26,693,464 T7P probably benign Het
Endod1 A T 9: 14,380,951 L7Q probably damaging Het
Galnt14 C T 17: 73,495,667 V477M probably damaging Het
Glis2 C T 16: 4,611,641 R211C probably damaging Het
Gm3376 T A Y: 3,775,370 M40K possibly damaging Het
Gm340 T A 19: 41,585,032 L742Q probably damaging Het
Gm4744 A T 6: 40,948,563 V122D Het
Gm4952 G A 19: 12,626,726 M167I probably benign Het
Gm6657 A T 12: 78,197,324 N17I Het
Gm8251 A C 1: 44,056,147 Y1930* probably null Het
Hyal4 T C 6: 24,756,509 V242A possibly damaging Het
Ift122 T G 6: 115,880,685 S131A probably benign Het
Il4ra T A 7: 125,569,986 S137T possibly damaging Het
Lpin2 A G 17: 71,231,190 K315R probably benign Het
Map3k6 T C 4: 133,252,463 Y1258H probably damaging Het
Mapk9 A T 11: 49,878,412 K290N probably damaging Het
Mfhas1 C T 8: 35,676,749 H1045Y possibly damaging Het
Ndufaf7 C A 17: 78,938,607 Q90K probably damaging Het
Nlrc3 A T 16: 3,953,977 V157E probably benign Het
Npas4 A G 19: 4,985,809 F776L probably benign Het
Nuggc A C 14: 65,611,154 D184A probably benign Het
Ogdhl A G 14: 32,344,721 E795G probably damaging Het
Olfr459 T G 6: 41,772,006 I98L probably benign Het
Olfr76 A G 19: 12,120,145 I189T probably damaging Het
Pcbp1 A T 6: 86,525,695 M74K possibly damaging Het
Plk4 A G 3: 40,808,822 D476G probably benign Het
Prox2 G A 12: 85,094,992 Q146* probably null Het
Rab44 A T 17: 29,145,303 Y617F unknown Het
Rabepk T C 2: 34,785,615 R168G probably benign Het
Rif1 T G 2: 52,110,454 S1307A probably benign Het
Ror2 C T 13: 53,111,431 V542I probably benign Het
Rtp1 A G 16: 23,431,409 I175V possibly damaging Het
Slc11a2 T A 15: 100,406,344 I158F probably damaging Het
Slc24a3 T G 2: 145,613,628 M479R probably damaging Het
Slc4a9 T C 18: 36,535,536 F723S probably damaging Het
Syne2 C A 12: 75,880,360 N93K probably damaging Het
Sytl2 A G 7: 90,408,391 Q846R probably damaging Het
Tas2r116 A C 6: 132,856,177 H247P probably benign Het
Tcstv3 T C 13: 120,317,594 S10P probably damaging Het
Tgm7 T C 2: 121,104,125 N124S probably benign Het
Tmem219 A T 7: 126,891,761 Y175N probably damaging Het
Tnfrsf18 G A 4: 156,028,027 G114S possibly damaging Het
Trim38 G A 13: 23,782,705 C45Y probably benign Het
Tshz1 T C 18: 84,014,279 E668G probably benign Het
Ubr4 T A 4: 139,421,139 M382K Het
Vps39 T C 2: 120,324,698 E549G possibly damaging Het
Zbtb46 A G 2: 181,411,755 L388P probably benign Het
Zdhhc25 T A 15: 88,601,104 M214K probably damaging Het
Zfp735 G A 11: 73,712,110 E627K possibly damaging Het
Other mutations in Wdr35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Wdr35 APN 12 9019900 missense probably benign
IGL00962:Wdr35 APN 12 9021726 splice site probably benign
IGL01094:Wdr35 APN 12 9005838 splice site probably benign
IGL01312:Wdr35 APN 12 9008655 missense probably damaging 1.00
IGL01397:Wdr35 APN 12 9008550 missense probably benign 0.04
IGL01490:Wdr35 APN 12 8977381 missense probably damaging 0.98
IGL02153:Wdr35 APN 12 9008535 missense probably null 0.04
IGL02319:Wdr35 APN 12 9027480 unclassified probably benign
IGL02548:Wdr35 APN 12 9024297 missense probably benign 0.00
IGL02941:Wdr35 APN 12 9027507 missense probably damaging 0.98
IGL03038:Wdr35 APN 12 8974185 splice site probably benign
IGL03086:Wdr35 APN 12 9008692 splice site probably null
IGL03207:Wdr35 APN 12 8989936 missense probably damaging 0.98
IGL03327:Wdr35 APN 12 8978694 splice site probably benign
R0362:Wdr35 UTSW 12 8995625 unclassified probably benign
R0464:Wdr35 UTSW 12 9027472 unclassified probably benign
R0487:Wdr35 UTSW 12 9012743 critical splice donor site probably null
R0976:Wdr35 UTSW 12 8986104 missense probably benign 0.03
R1349:Wdr35 UTSW 12 9019870 splice site probably benign
R1663:Wdr35 UTSW 12 9020000 missense probably benign 0.00
R1769:Wdr35 UTSW 12 9012728 missense probably damaging 1.00
R1779:Wdr35 UTSW 12 8985772 missense possibly damaging 0.62
R1789:Wdr35 UTSW 12 8977435 critical splice donor site probably null
R1893:Wdr35 UTSW 12 8985994 missense probably benign
R2076:Wdr35 UTSW 12 9024281 missense possibly damaging 0.88
R2228:Wdr35 UTSW 12 8974955 missense possibly damaging 0.65
R2280:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2281:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2863:Wdr35 UTSW 12 9028060 nonsense probably null
R3713:Wdr35 UTSW 12 9027648 missense possibly damaging 0.68
R3911:Wdr35 UTSW 12 8986077 missense probably benign
R3934:Wdr35 UTSW 12 9008014 missense probably damaging 1.00
R4360:Wdr35 UTSW 12 8974149 utr 5 prime probably benign
R4402:Wdr35 UTSW 12 8989981 missense probably damaging 0.98
R4473:Wdr35 UTSW 12 9015995 missense probably benign 0.00
R4656:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R4780:Wdr35 UTSW 12 9018150 missense probably benign
R5092:Wdr35 UTSW 12 8987327 missense probably damaging 1.00
R5160:Wdr35 UTSW 12 9008487 missense probably damaging 0.99
R5184:Wdr35 UTSW 12 9018142 missense probably damaging 1.00
R5346:Wdr35 UTSW 12 8978684 missense probably benign 0.00
R5435:Wdr35 UTSW 12 8989951 missense probably benign 0.01
R5472:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R5682:Wdr35 UTSW 12 8981125 missense probably damaging 1.00
R5801:Wdr35 UTSW 12 9006723 missense possibly damaging 0.92
R5990:Wdr35 UTSW 12 9016511 missense probably damaging 1.00
R6196:Wdr35 UTSW 12 9027632 missense probably benign 0.05
R6531:Wdr35 UTSW 12 8978685 missense probably benign 0.00
R6746:Wdr35 UTSW 12 9003982 splice site probably null
R6816:Wdr35 UTSW 12 9027724 critical splice donor site probably null
R6863:Wdr35 UTSW 12 8990047 missense probably damaging 0.97
R7088:Wdr35 UTSW 12 8978659 missense probably benign 0.11
R7140:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7327:Wdr35 UTSW 12 8987312 missense probably benign 0.10
R7403:Wdr35 UTSW 12 9012685 missense probably damaging 0.98
R7422:Wdr35 UTSW 12 9004105 missense probably benign 0.00
R7438:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7466:Wdr35 UTSW 12 9005773 missense probably benign
R7491:Wdr35 UTSW 12 8986000 missense probably benign 0.00
R7599:Wdr35 UTSW 12 9024886 missense probably benign 0.01
R7620:Wdr35 UTSW 12 9016042 missense probably benign 0.04
R7857:Wdr35 UTSW 12 9008113 critical splice donor site probably null
R8289:Wdr35 UTSW 12 9008020 missense probably benign 0.00
R8302:Wdr35 UTSW 12 9028110 missense probably benign 0.09
R8433:Wdr35 UTSW 12 9008495 missense probably damaging 1.00
R8479:Wdr35 UTSW 12 8985985 missense probably benign 0.04
R8498:Wdr35 UTSW 12 9008626 missense probably damaging 0.97
R8721:Wdr35 UTSW 12 9025044 critical splice donor site probably null
R9220:Wdr35 UTSW 12 8986000 missense possibly damaging 0.49
R9368:Wdr35 UTSW 12 9021826 missense probably benign 0.00
R9596:Wdr35 UTSW 12 8986092 missense probably benign 0.08
R9773:Wdr35 UTSW 12 8989990 missense probably benign 0.03
X0066:Wdr35 UTSW 12 8990029 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCTTGGCTAGTATAAAGCACTG -3'
(R):5'- CCAGCACTGTACAACTGAGAG -3'

Sequencing Primer
(F):5'- CTACATGAGTGTAGTAAAGCTAT -3'
(R):5'- GCACTGTACAACTGAGAGTCTTC -3'
Posted On 2022-08-09