Incidental Mutation 'R9573:Tshz1'
ID 722150
Institutional Source Beutler Lab
Gene Symbol Tshz1
Ensembl Gene ENSMUSG00000046982
Gene Name teashirt zinc finger family member 1
Synonyms Mtsh1, teashirt1, Sdccag33, D18Bwg1409e, Tsh1, NY-CO-33, 5730407I04Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9573 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 84011627-84086404 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84014279 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 668 (E668G)
Ref Sequence ENSEMBL: ENSMUSP00000089388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060303]
AlphaFold Q5DTH5
Predicted Effect probably benign
Transcript: ENSMUST00000060303
AA Change: E668G

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000089388
Gene: ENSMUSG00000046982
AA Change: E668G

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 153 195 N/A INTRINSIC
ZnF_C2H2 246 270 1.86e0 SMART
ZnF_C2H2 307 331 3.83e-2 SMART
ZnF_C2H2 416 440 5.34e0 SMART
low complexity region 497 515 N/A INTRINSIC
HOX 890 964 4.15e-4 SMART
ZnF_C2H2 976 998 4.34e-1 SMART
ZnF_C2H2 1044 1067 4.47e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a colon cancer antigen that was defined by serological analysis of recombinant cDNA expression libraries. The encoded protein is a member of the teashirt C2H2-type zinc-finger protein family and may be involved in transcriptional regulation of developmental processes. Mutations in this gene may be associated with congenital aural atresia syndrome. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele die shortly after birth of respiratory distress, have defects in soft palate formation, have altered axial skeleton and have middle ear defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,465,778 I548N probably damaging Het
Afdn T A 17: 13,829,967 V472E probably damaging Het
Ak3 T C 19: 29,026,267 I170V probably benign Het
Ank3 T A 10: 69,956,147 L1058* probably null Het
Ankrd60 A G 2: 173,568,998 V243A possibly damaging Het
Apol11b C T 15: 77,640,571 E5K possibly damaging Het
Arid3c T G 4: 41,726,003 E200A probably benign Het
Astn2 T G 4: 65,648,354 I856L probably benign Het
Bcs1l C A 1: 74,590,333 R177S probably damaging Het
Bin2 A T 15: 100,662,552 F43I probably damaging Het
Braf A G 6: 39,623,610 L691P probably damaging Het
Bud23 C T 5: 135,053,420 V266I possibly damaging Het
Casp12 A T 9: 5,354,629 I333L probably benign Het
Cavin2 T A 1: 51,289,636 I84N probably damaging Het
Cep170b T A 12: 112,724,720 F24I probably damaging Het
Chd9 A G 8: 90,977,674 Y719C unknown Het
Commd7 A G 2: 153,622,061 M137T probably damaging Het
Dmbt1 G A 7: 131,056,180 probably null Het
Dnah12 A C 14: 26,693,464 T7P probably benign Het
Endod1 A T 9: 14,380,951 L7Q probably damaging Het
Galnt14 C T 17: 73,495,667 V477M probably damaging Het
Glis2 C T 16: 4,611,641 R211C probably damaging Het
Gm3376 T A Y: 3,775,370 M40K possibly damaging Het
Gm340 T A 19: 41,585,032 L742Q probably damaging Het
Gm4744 A T 6: 40,948,563 V122D Het
Gm4952 G A 19: 12,626,726 M167I probably benign Het
Gm6657 A T 12: 78,197,324 N17I Het
Gm8251 A C 1: 44,056,147 Y1930* probably null Het
Hyal4 T C 6: 24,756,509 V242A possibly damaging Het
Ift122 T G 6: 115,880,685 S131A probably benign Het
Il4ra T A 7: 125,569,986 S137T possibly damaging Het
Lpin2 A G 17: 71,231,190 K315R probably benign Het
Map3k6 T C 4: 133,252,463 Y1258H probably damaging Het
Mapk9 A T 11: 49,878,412 K290N probably damaging Het
Mfhas1 C T 8: 35,676,749 H1045Y possibly damaging Het
Ndufaf7 C A 17: 78,938,607 Q90K probably damaging Het
Nlrc3 A T 16: 3,953,977 V157E probably benign Het
Npas4 A G 19: 4,985,809 F776L probably benign Het
Nuggc A C 14: 65,611,154 D184A probably benign Het
Ogdhl A G 14: 32,344,721 E795G probably damaging Het
Olfr459 T G 6: 41,772,006 I98L probably benign Het
Olfr76 A G 19: 12,120,145 I189T probably damaging Het
Pcbp1 A T 6: 86,525,695 M74K possibly damaging Het
Plk4 A G 3: 40,808,822 D476G probably benign Het
Prox2 G A 12: 85,094,992 Q146* probably null Het
Rab44 A T 17: 29,145,303 Y617F unknown Het
Rabepk T C 2: 34,785,615 R168G probably benign Het
Rif1 T G 2: 52,110,454 S1307A probably benign Het
Ror2 C T 13: 53,111,431 V542I probably benign Het
Rtp1 A G 16: 23,431,409 I175V possibly damaging Het
Slc11a2 T A 15: 100,406,344 I158F probably damaging Het
Slc24a3 T G 2: 145,613,628 M479R probably damaging Het
Slc4a9 T C 18: 36,535,536 F723S probably damaging Het
Syne2 C A 12: 75,880,360 N93K probably damaging Het
Sytl2 A G 7: 90,408,391 Q846R probably damaging Het
Tas2r116 A C 6: 132,856,177 H247P probably benign Het
Tcstv3 T C 13: 120,317,594 S10P probably damaging Het
Tgm7 T C 2: 121,104,125 N124S probably benign Het
Tmem219 A T 7: 126,891,761 Y175N probably damaging Het
Tnfrsf18 G A 4: 156,028,027 G114S possibly damaging Het
Trim38 G A 13: 23,782,705 C45Y probably benign Het
Ubr4 T A 4: 139,421,139 M382K Het
Vps39 T C 2: 120,324,698 E549G possibly damaging Het
Wdr35 G A 12: 9,028,014 G1135D probably benign Het
Zbtb46 A G 2: 181,411,755 L388P probably benign Het
Zdhhc25 T A 15: 88,601,104 M214K probably damaging Het
Zfp735 G A 11: 73,712,110 E627K possibly damaging Het
Other mutations in Tshz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Tshz1 APN 18 84013509 missense possibly damaging 0.94
IGL02934:Tshz1 APN 18 84013090 missense probably damaging 1.00
ANU18:Tshz1 UTSW 18 84014661 missense probably damaging 1.00
PIT4810001:Tshz1 UTSW 18 84013250 missense possibly damaging 0.85
R0052:Tshz1 UTSW 18 84014945 missense possibly damaging 0.76
R0052:Tshz1 UTSW 18 84014945 missense possibly damaging 0.76
R0364:Tshz1 UTSW 18 84016124 missense probably benign 0.31
R0391:Tshz1 UTSW 18 84016049 missense possibly damaging 0.93
R0515:Tshz1 UTSW 18 84015965 missense probably benign
R0942:Tshz1 UTSW 18 84013053 missense probably damaging 0.99
R0943:Tshz1 UTSW 18 84015231 missense probably benign 0.04
R1472:Tshz1 UTSW 18 84013805 missense possibly damaging 0.93
R1895:Tshz1 UTSW 18 84013433 missense probably damaging 1.00
R2022:Tshz1 UTSW 18 84013862 missense probably damaging 0.98
R2860:Tshz1 UTSW 18 84014980 missense probably damaging 1.00
R2861:Tshz1 UTSW 18 84014980 missense probably damaging 1.00
R4027:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4028:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4030:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4031:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4119:Tshz1 UTSW 18 84014189 missense probably benign 0.00
R4233:Tshz1 UTSW 18 84016195 missense probably benign 0.00
R4573:Tshz1 UTSW 18 84015082 missense probably damaging 1.00
R4604:Tshz1 UTSW 18 84013374 missense probably damaging 1.00
R4960:Tshz1 UTSW 18 84014862 missense probably benign 0.08
R5085:Tshz1 UTSW 18 84013928 missense probably benign 0.01
R5124:Tshz1 UTSW 18 84015467 missense probably damaging 1.00
R5150:Tshz1 UTSW 18 84013215 nonsense probably null
R5357:Tshz1 UTSW 18 84015080 missense probably damaging 1.00
R5530:Tshz1 UTSW 18 84013268 missense probably damaging 1.00
R5718:Tshz1 UTSW 18 84014524 missense probably damaging 1.00
R5750:Tshz1 UTSW 18 84013961 missense possibly damaging 0.93
R5778:Tshz1 UTSW 18 84015680 missense probably damaging 1.00
R6052:Tshz1 UTSW 18 84014069 missense probably damaging 1.00
R6279:Tshz1 UTSW 18 84015311 missense probably damaging 1.00
R6393:Tshz1 UTSW 18 84013220 missense probably damaging 1.00
R6407:Tshz1 UTSW 18 84015966 missense possibly damaging 0.55
R6425:Tshz1 UTSW 18 84015563 missense probably damaging 0.99
R6998:Tshz1 UTSW 18 84015841 missense probably benign 0.00
R7165:Tshz1 UTSW 18 84015927 missense probably damaging 1.00
R7233:Tshz1 UTSW 18 84014819 missense possibly damaging 0.63
R7330:Tshz1 UTSW 18 84014831 missense probably damaging 0.96
R7491:Tshz1 UTSW 18 84015641 missense probably damaging 1.00
R7579:Tshz1 UTSW 18 84014665 nonsense probably null
R7592:Tshz1 UTSW 18 84014048 missense probably damaging 1.00
R7659:Tshz1 UTSW 18 84016075 missense probably damaging 0.97
R7702:Tshz1 UTSW 18 84014336 missense probably damaging 1.00
R7844:Tshz1 UTSW 18 84014171 missense probably benign 0.00
R7908:Tshz1 UTSW 18 84014607 nonsense probably null
R7941:Tshz1 UTSW 18 84015392 missense possibly damaging 0.91
R7947:Tshz1 UTSW 18 84015657 missense probably damaging 1.00
R8435:Tshz1 UTSW 18 84014024 missense probably damaging 1.00
R8750:Tshz1 UTSW 18 84015037 missense probably damaging 1.00
R8774:Tshz1 UTSW 18 84014976 missense possibly damaging 0.96
R8774-TAIL:Tshz1 UTSW 18 84014976 missense possibly damaging 0.96
R9029:Tshz1 UTSW 18 84013514 missense probably damaging 0.98
R9031:Tshz1 UTSW 18 84014862 missense probably benign 0.08
R9584:Tshz1 UTSW 18 84014964 missense probably damaging 1.00
R9596:Tshz1 UTSW 18 84013779 missense possibly damaging 0.92
R9701:Tshz1 UTSW 18 84014454 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGATGATACCCAGATGGCCG -3'
(R):5'- AATACAGCCGTCTTACGCC -3'

Sequencing Primer
(F):5'- GCAGCCATTGGTGACCTTG -3'
(R):5'- CAGCAGCGTGAAGTCACTGTC -3'
Posted On 2022-08-09