Incidental Mutation 'R9573:Npas4'
ID 722151
Institutional Source Beutler Lab
Gene Symbol Npas4
Ensembl Gene ENSMUSG00000045903
Gene Name neuronal PAS domain protein 4
Synonyms Npas4, LE-PAS, Nxf
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.554) question?
Stock # R9573 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 4984355-4989971 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4985809 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 776 (F776L)
Ref Sequence ENSEMBL: ENSMUSP00000062992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056129]
AlphaFold Q8BGD7
Predicted Effect probably benign
Transcript: ENSMUST00000056129
AA Change: F776L

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000062992
Gene: ENSMUSG00000045903
AA Change: F776L

DomainStartEndE-ValueType
Blast:HLH 6 56 1e-26 BLAST
low complexity region 57 69 N/A INTRINSIC
PAS 72 140 1.88e-6 SMART
low complexity region 197 211 N/A INTRINSIC
PAS 213 273 5.66e-1 SMART
internal_repeat_1 394 473 1.35e-6 PROSPERO
internal_repeat_1 467 556 1.35e-6 PROSPERO
low complexity region 657 676 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NXF is a member of the basic helix-loop-helix-PER (MIM 602260)-ARNT (MIM 126110)-SIM (see SIM2; MIM 600892) (bHLH-PAS) class of transcriptional regulators, which are involved in a wide range of physiologic and developmental events (Ooe et al., 2004 [PubMed 14701734]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit hyperactivity, seizures and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,465,778 I548N probably damaging Het
Afdn T A 17: 13,829,967 V472E probably damaging Het
Ak3 T C 19: 29,026,267 I170V probably benign Het
Ank3 T A 10: 69,956,147 L1058* probably null Het
Ankrd60 A G 2: 173,568,998 V243A possibly damaging Het
Apol11b C T 15: 77,640,571 E5K possibly damaging Het
Arid3c T G 4: 41,726,003 E200A probably benign Het
Astn2 T G 4: 65,648,354 I856L probably benign Het
Bcs1l C A 1: 74,590,333 R177S probably damaging Het
Bin2 A T 15: 100,662,552 F43I probably damaging Het
Braf A G 6: 39,623,610 L691P probably damaging Het
Bud23 C T 5: 135,053,420 V266I possibly damaging Het
Casp12 A T 9: 5,354,629 I333L probably benign Het
Cavin2 T A 1: 51,289,636 I84N probably damaging Het
Cep170b T A 12: 112,724,720 F24I probably damaging Het
Chd9 A G 8: 90,977,674 Y719C unknown Het
Commd7 A G 2: 153,622,061 M137T probably damaging Het
Dmbt1 G A 7: 131,056,180 probably null Het
Dnah12 A C 14: 26,693,464 T7P probably benign Het
Endod1 A T 9: 14,380,951 L7Q probably damaging Het
Galnt14 C T 17: 73,495,667 V477M probably damaging Het
Glis2 C T 16: 4,611,641 R211C probably damaging Het
Gm3376 T A Y: 3,775,370 M40K possibly damaging Het
Gm340 T A 19: 41,585,032 L742Q probably damaging Het
Gm4744 A T 6: 40,948,563 V122D Het
Gm4952 G A 19: 12,626,726 M167I probably benign Het
Gm6657 A T 12: 78,197,324 N17I Het
Gm8251 A C 1: 44,056,147 Y1930* probably null Het
Hyal4 T C 6: 24,756,509 V242A possibly damaging Het
Ift122 T G 6: 115,880,685 S131A probably benign Het
Il4ra T A 7: 125,569,986 S137T possibly damaging Het
Lpin2 A G 17: 71,231,190 K315R probably benign Het
Map3k6 T C 4: 133,252,463 Y1258H probably damaging Het
Mapk9 A T 11: 49,878,412 K290N probably damaging Het
Mfhas1 C T 8: 35,676,749 H1045Y possibly damaging Het
Ndufaf7 C A 17: 78,938,607 Q90K probably damaging Het
Nlrc3 A T 16: 3,953,977 V157E probably benign Het
Nuggc A C 14: 65,611,154 D184A probably benign Het
Ogdhl A G 14: 32,344,721 E795G probably damaging Het
Olfr459 T G 6: 41,772,006 I98L probably benign Het
Olfr76 A G 19: 12,120,145 I189T probably damaging Het
Pcbp1 A T 6: 86,525,695 M74K possibly damaging Het
Plk4 A G 3: 40,808,822 D476G probably benign Het
Prox2 G A 12: 85,094,992 Q146* probably null Het
Rab44 A T 17: 29,145,303 Y617F unknown Het
Rabepk T C 2: 34,785,615 R168G probably benign Het
Rif1 T G 2: 52,110,454 S1307A probably benign Het
Ror2 C T 13: 53,111,431 V542I probably benign Het
Rtp1 A G 16: 23,431,409 I175V possibly damaging Het
Slc11a2 T A 15: 100,406,344 I158F probably damaging Het
Slc24a3 T G 2: 145,613,628 M479R probably damaging Het
Slc4a9 T C 18: 36,535,536 F723S probably damaging Het
Syne2 C A 12: 75,880,360 N93K probably damaging Het
Sytl2 A G 7: 90,408,391 Q846R probably damaging Het
Tas2r116 A C 6: 132,856,177 H247P probably benign Het
Tcstv3 T C 13: 120,317,594 S10P probably damaging Het
Tgm7 T C 2: 121,104,125 N124S probably benign Het
Tmem219 A T 7: 126,891,761 Y175N probably damaging Het
Tnfrsf18 G A 4: 156,028,027 G114S possibly damaging Het
Trim38 G A 13: 23,782,705 C45Y probably benign Het
Tshz1 T C 18: 84,014,279 E668G probably benign Het
Ubr4 T A 4: 139,421,139 M382K Het
Vps39 T C 2: 120,324,698 E549G possibly damaging Het
Wdr35 G A 12: 9,028,014 G1135D probably benign Het
Zbtb46 A G 2: 181,411,755 L388P probably benign Het
Zdhhc25 T A 15: 88,601,104 M214K probably damaging Het
Zfp735 G A 11: 73,712,110 E627K possibly damaging Het
Other mutations in Npas4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Npas4 APN 19 4987327 missense possibly damaging 0.93
IGL01865:Npas4 APN 19 4985791 nonsense probably null
IGL02746:Npas4 APN 19 4986667 missense probably damaging 0.99
IGL03061:Npas4 APN 19 4986337 missense probably damaging 1.00
IGL03340:Npas4 APN 19 4985066 utr 3 prime probably benign
R0879:Npas4 UTSW 19 4986916 missense probably benign
R0920:Npas4 UTSW 19 4986316 nonsense probably null
R1751:Npas4 UTSW 19 4988183 missense probably benign 0.05
R1767:Npas4 UTSW 19 4988183 missense probably benign 0.05
R2066:Npas4 UTSW 19 4987414 missense probably damaging 0.99
R2201:Npas4 UTSW 19 4987364 missense probably benign 0.06
R3973:Npas4 UTSW 19 4986551 missense probably benign
R4117:Npas4 UTSW 19 4987363 missense probably damaging 0.99
R4846:Npas4 UTSW 19 4986777 missense probably benign 0.34
R5007:Npas4 UTSW 19 4989656 missense possibly damaging 0.61
R6155:Npas4 UTSW 19 4986870 missense probably damaging 1.00
R6255:Npas4 UTSW 19 4986375 missense probably damaging 1.00
R6488:Npas4 UTSW 19 4985983 missense probably damaging 1.00
R8427:Npas4 UTSW 19 4986080 missense probably benign
R8864:Npas4 UTSW 19 4988528 missense probably damaging 1.00
R9449:Npas4 UTSW 19 4988464 missense probably damaging 1.00
Z1177:Npas4 UTSW 19 4986242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTACTCATCTTTCACACAAAG -3'
(R):5'- TCTACTCCAGACCCCAATGG -3'

Sequencing Primer
(F):5'- ACTCATCTTTCACACAAAGCTTTG -3'
(R):5'- CCAATGGGGAATGGGGTTC -3'
Posted On 2022-08-09