Incidental Mutation 'R9574:Zfp638'
ID 722183
Institutional Source Beutler Lab
Gene Symbol Zfp638
Ensembl Gene ENSMUSG00000030016
Gene Name zinc finger protein 638
Synonyms Np220, Zfml
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock # R9574 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 83867109-83989550 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 83979698 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1762 (D1762E)
Ref Sequence ENSEMBL: ENSMUSP00000144989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032088] [ENSMUST00000113835] [ENSMUST00000113836] [ENSMUST00000203324] [ENSMUST00000203891] [ENSMUST00000204751]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000032088
Gene: ENSMUSG00000030016
AA Change: D1762E

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113835
SMART Domains Protein: ENSMUSP00000109466
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 880 949 9.04e-3 SMART
Blast:RRM_2 984 1052 2e-25 BLAST
low complexity region 1095 1109 N/A INTRINSIC
ZnF_U1 1218 1252 2.84e-8 SMART
ZnF_C2H2 1221 1245 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113836
SMART Domains Protein: ENSMUSP00000109467
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1222 1256 2.84e-8 SMART
ZnF_C2H2 1225 1249 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203324
SMART Domains Protein: ENSMUSP00000145124
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1220 1254 1.7e-10 SMART
ZnF_C2H2 1223 1247 8.9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203891
SMART Domains Protein: ENSMUSP00000144939
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1186 1220 1.7e-10 SMART
ZnF_C2H2 1189 1213 8.9e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204751
AA Change: D1762E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144989
Gene: ENSMUSG00000030016
AA Change: D1762E

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleoplasmic protein. It binds cytidine-rich sequences in double-stranded DNA. This protein has three types of domains: MH1, MH2 (repeated three times) and MH3. It is associated with packaging, transferring, or processing transcripts. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T A 11: 48,947,669 E697V probably damaging Het
Actn4 T C 7: 28,895,439 D805G probably benign Het
Adam2 C T 14: 66,037,622 S554N probably benign Het
Adra2b A G 2: 127,364,363 T267A probably benign Het
Apobec4 A T 1: 152,756,664 T148S probably damaging Het
B4galt1 T A 4: 40,853,766 M14L probably benign Het
Bok C A 1: 93,689,225 Q98K probably benign Het
Cacnb4 A T 2: 52,437,004 L394Q probably damaging Het
Ccar2 T C 14: 70,143,656 K287E probably benign Het
Cdyl2 T A 8: 116,623,930 E154V probably benign Het
Cenpn T G 8: 116,933,410 Y160D probably damaging Het
Cfap20 T C 8: 95,422,886 Y58C probably benign Het
Creb5 T A 6: 53,681,054 L123Q unknown Het
Cspg4 G A 9: 56,890,058 V1269M probably damaging Het
Cyp2b19 A T 7: 26,766,927 K385M probably damaging Het
Cyp2b19 G T 7: 26,766,928 K385N probably null Het
Ercc2 C A 7: 19,390,135 D422E probably benign Het
Fbxl12 A G 9: 20,638,813 V129A possibly damaging Het
Fbxo11 T C 17: 88,014,523 E84G Het
Fmn1 T C 2: 113,595,057 L1192S probably damaging Het
Galk2 T C 2: 125,983,059 F392L probably benign Het
Gas2l3 G A 10: 89,422,273 H153Y probably damaging Het
Gcn1l1 A T 5: 115,575,282 K101N possibly damaging Het
Gmfg C T 7: 28,445,934 Q101* probably null Het
Gpr108 C T 17: 57,238,039 C309Y probably damaging Het
Hist1h3g T C 13: 23,535,591 L49P probably damaging Het
Hscb A T 5: 110,834,729 I164N probably damaging Het
Kifc2 T C 15: 76,662,197 W260R probably damaging Het
Lrp6 T A 6: 134,470,699 D995V possibly damaging Het
Lrrc1 T A 9: 77,451,426 I308F probably damaging Het
Map7 C T 10: 20,278,220 A694V unknown Het
Mapre2 A G 18: 23,832,936 D68G probably benign Het
Mertk A T 2: 128,751,960 I295F probably benign Het
Mst1 T A 9: 108,084,854 C690* probably null Het
Nde1 A G 16: 14,170,481 E76G probably damaging Het
Nek5 T C 8: 22,074,024 T597A probably benign Het
Nup210l T C 3: 90,210,386 F1800L probably benign Het
Olfr368 A G 2: 37,332,136 I130V possibly damaging Het
Pdpn T A 4: 143,270,531 D131V probably benign Het
Pot1a T C 6: 25,775,719 T118A possibly damaging Het
Prom1 A G 5: 44,000,837 I843T probably benign Het
Prrt3 T C 6: 113,497,626 T212A probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Rarb A T 14: 16,574,858 S53T probably damaging Het
Rnft2 A G 5: 118,237,265 S140P probably benign Het
Rxfp1 T C 3: 79,656,274 M362V probably benign Het
Sall2 G A 14: 52,314,160 T526M probably damaging Het
Scube1 T C 15: 83,616,799 D598G Het
Sema3f T A 9: 107,689,773 I186F possibly damaging Het
Shank2 A G 7: 144,068,725 T199A possibly damaging Het
Sipa1l2 T A 8: 125,442,714 M1427L probably benign Het
Sis C T 3: 72,921,157 G1195D probably benign Het
Slc25a39 A T 11: 102,404,564 H193Q probably benign Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Srgn A C 10: 62,507,665 L17R probably damaging Het
Stard5 A G 7: 83,632,736 N34D probably benign Het
Syt8 A T 7: 142,439,466 D220V probably damaging Het
Tex15 A G 8: 33,574,481 E1313G probably benign Het
Tmem131l T C 3: 83,961,604 R155G probably damaging Het
Tmem220 T C 11: 67,025,267 V30A probably damaging Het
Tmem8 T C 17: 26,118,887 V415A probably damaging Het
Tollip A G 7: 141,891,994 I119T probably damaging Het
Treml4 G A 17: 48,264,644 G25D probably damaging Het
Trim7 T C 11: 48,837,633 F36S probably damaging Het
Txnrd3 T A 6: 89,663,184 C293* probably null Het
Utp14b A G 1: 78,665,765 D460G probably benign Het
Vmn2r41 T A 7: 8,150,330 N397Y probably benign Het
Vmn2r67 T C 7: 85,136,809 I663V probably benign Het
Zfp292 T A 4: 34,839,460 H135L probably damaging Het
Zfp420 C T 7: 29,876,055 R567* probably null Het
Zfp518b C T 5: 38,673,430 V411M probably benign Het
Zfp691 T A 4: 119,171,033 M1L possibly damaging Het
Other mutations in Zfp638
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Zfp638 APN 6 83979718 missense probably damaging 1.00
IGL00514:Zfp638 APN 6 83956698 missense probably damaging 1.00
IGL00705:Zfp638 APN 6 83977130 missense probably damaging 1.00
IGL00785:Zfp638 APN 6 83929164 missense probably damaging 1.00
IGL01068:Zfp638 APN 6 83934994 missense probably damaging 1.00
IGL01084:Zfp638 APN 6 83944798 missense probably benign 0.01
IGL01570:Zfp638 APN 6 83947847 missense probably damaging 1.00
IGL01758:Zfp638 APN 6 83979526 missense probably damaging 0.96
IGL02345:Zfp638 APN 6 83984875 missense probably damaging 1.00
IGL02939:Zfp638 APN 6 83969232 missense probably damaging 0.98
IGL03007:Zfp638 APN 6 83984884 missense probably damaging 1.00
IGL03118:Zfp638 APN 6 83935018 splice site probably benign
IGL03135:Zfp638 APN 6 83942875 missense probably damaging 1.00
IGL03264:Zfp638 APN 6 83946247 missense probably benign 0.04
R0190:Zfp638 UTSW 6 83928964 missense probably damaging 1.00
R0200:Zfp638 UTSW 6 83967354 missense probably damaging 1.00
R0766:Zfp638 UTSW 6 83929041 missense probably damaging 1.00
R0801:Zfp638 UTSW 6 83972238 unclassified probably benign
R0938:Zfp638 UTSW 6 83984041 missense probably benign 0.16
R1312:Zfp638 UTSW 6 83929041 missense probably damaging 1.00
R1458:Zfp638 UTSW 6 83944656 missense probably damaging 1.00
R1584:Zfp638 UTSW 6 83978065 splice site probably null
R1634:Zfp638 UTSW 6 83979912 splice site probably null
R1651:Zfp638 UTSW 6 83954737 missense probably benign 0.00
R2079:Zfp638 UTSW 6 83953389 critical splice donor site probably null
R2134:Zfp638 UTSW 6 83928982 missense probably damaging 1.00
R2142:Zfp638 UTSW 6 83986596 missense probably damaging 1.00
R2201:Zfp638 UTSW 6 83929518 missense probably damaging 1.00
R2422:Zfp638 UTSW 6 83966439 splice site probably benign
R4353:Zfp638 UTSW 6 83984059 missense probably damaging 0.97
R4681:Zfp638 UTSW 6 83981737 missense possibly damaging 0.50
R4716:Zfp638 UTSW 6 83979562 nonsense probably null
R4807:Zfp638 UTSW 6 83943058 missense probably damaging 1.00
R4850:Zfp638 UTSW 6 83979475 missense possibly damaging 0.92
R5079:Zfp638 UTSW 6 83929456 missense probably benign 0.03
R5236:Zfp638 UTSW 6 83976575 nonsense probably null
R5323:Zfp638 UTSW 6 83962094 missense probably damaging 0.96
R5426:Zfp638 UTSW 6 83976414 missense probably damaging 1.00
R5557:Zfp638 UTSW 6 83967363 missense probably damaging 1.00
R5570:Zfp638 UTSW 6 83979188 missense probably damaging 1.00
R5614:Zfp638 UTSW 6 83929641 missense probably damaging 1.00
R5662:Zfp638 UTSW 6 83943129 missense probably damaging 0.97
R5685:Zfp638 UTSW 6 83929987 missense probably damaging 1.00
R5689:Zfp638 UTSW 6 83929072 missense probably damaging 1.00
R5783:Zfp638 UTSW 6 83944847 missense possibly damaging 0.92
R5856:Zfp638 UTSW 6 83977065 missense probably damaging 1.00
R6310:Zfp638 UTSW 6 83867230 missense possibly damaging 0.90
R6477:Zfp638 UTSW 6 83965578 missense probably damaging 1.00
R6557:Zfp638 UTSW 6 83930110 missense probably damaging 1.00
R7084:Zfp638 UTSW 6 83953126 missense possibly damaging 0.50
R7101:Zfp638 UTSW 6 83954726 missense probably benign 0.00
R7141:Zfp638 UTSW 6 83867199 missense unknown
R7368:Zfp638 UTSW 6 83929455 missense possibly damaging 0.60
R7402:Zfp638 UTSW 6 83928688 missense possibly damaging 0.92
R7455:Zfp638 UTSW 6 83930145 missense probably damaging 1.00
R7762:Zfp638 UTSW 6 83976272 missense probably damaging 1.00
R7773:Zfp638 UTSW 6 83979214 missense probably damaging 1.00
R8090:Zfp638 UTSW 6 83929819 missense probably damaging 0.99
R8154:Zfp638 UTSW 6 83977409 missense probably damaging 1.00
R8161:Zfp638 UTSW 6 83929731 missense possibly damaging 0.85
R8327:Zfp638 UTSW 6 83928697 missense probably damaging 0.99
R8384:Zfp638 UTSW 6 83979765 missense probably benign 0.28
R8703:Zfp638 UTSW 6 83977161 missense probably damaging 0.96
R8738:Zfp638 UTSW 6 83954763 critical splice donor site probably null
R8865:Zfp638 UTSW 6 83977053 missense possibly damaging 0.91
R8874:Zfp638 UTSW 6 83969153 missense probably damaging 1.00
R9080:Zfp638 UTSW 6 83867173 missense unknown
R9113:Zfp638 UTSW 6 83976912 missense probably damaging 0.96
R9661:Zfp638 UTSW 6 83946338 missense probably damaging 0.99
R9722:Zfp638 UTSW 6 83946319 missense probably damaging 1.00
R9745:Zfp638 UTSW 6 83944813 missense probably benign 0.27
Z1088:Zfp638 UTSW 6 83944811 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACGCTTGGTAACTGTGGATG -3'
(R):5'- ACAGTTTCACTTCCTGGACC -3'

Sequencing Primer
(F):5'- GTCAGCAGACATAACTTTTGCTAC -3'
(R):5'- CTTCCTGGACCTACTTGGGAGAAAG -3'
Posted On 2022-08-09