Mutagenetix > Incidental Mutation

Incidental Mutation 'R9575:Flnc'

722238

Institutional Source

Beutler Lab

Gene Symbol

Flnc

Ensembl Gene

ENSMUSG00000068699

Gene Name

filamin C, gamma

Synonyms

1110055E19Rik, actin binding protein 280, Fln2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9575 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

29433256-29461883 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 29454400 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1937 (H1937R)

Ref Sequence

ENSEMBL: ENSMUSP00000064163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065090] [ENSMUST00000101617]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000065090
AA Change: H1937R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000064163
Gene: ENSMUSG00000068699
AA Change: H1937R

Domain	Start	End	E-Value	Type
CH	39	141	1.17e-25	SMART
CH	162	258	2.09e-22	SMART
IG_FLMN	275	372	3.84e-38	SMART
IG_FLMN	375	472	3.73e-36	SMART
IG_FLMN	474	569	4.41e-38	SMART
IG_FLMN	571	662	3.61e-34	SMART
IG_FLMN	667	762	2.48e-41	SMART
IG_FLMN	764	865	6.7e-29	SMART
IG_FLMN	867	964	3.42e-35	SMART
IG_FLMN	966	1060	2.92e-29	SMART
IG_FLMN	1062	1153	3.69e-40	SMART
IG_FLMN	1155	1248	6.53e-41	SMART
IG_FLMN	1250	1348	7.23e-34	SMART
IG_FLMN	1350	1441	2.04e-42	SMART
IG_FLMN	1443	1537	1.75e-41	SMART
IG_FLMN	1539	1634	1.31e-40	SMART
IG_FLMN	1636	1738	1.05e-30	SMART
IG_FLMN	1777	1858	2.93e-11	SMART
IG_FLMN	1859	1950	2.55e-43	SMART
IG_FLMN	1951	2037	2.43e-17	SMART
IG_FLMN	2041	2132	1.52e-41	SMART
PDB:2E9I\|A	2133	2162	3e-7	PDB
IG_FLMN	2217	2310	2.93e-11	SMART
IG_FLMN	2314	2405	1.67e-38	SMART
IG_FLMN	2408	2500	2.56e-25	SMART
IG_FLMN	2505	2596	9.54e-34	SMART
low complexity region	2618	2628	N/A	INTRINSIC
IG_FLMN	2635	2737	2.11e-26	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000101617
AA Change: H1904R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099139
Gene: ENSMUSG00000068699
AA Change: H1904R

Domain	Start	End	E-Value	Type
CH	39	141	1.17e-25	SMART
CH	162	258	2.09e-22	SMART
IG_FLMN	275	372	3.84e-38	SMART
IG_FLMN	375	472	3.73e-36	SMART
IG_FLMN	474	569	4.41e-38	SMART
IG_FLMN	571	662	3.61e-34	SMART
IG_FLMN	667	762	2.48e-41	SMART
IG_FLMN	764	865	6.7e-29	SMART
IG_FLMN	867	964	3.42e-35	SMART
IG_FLMN	966	1060	2.92e-29	SMART
IG_FLMN	1062	1153	3.69e-40	SMART
IG_FLMN	1155	1248	6.53e-41	SMART
IG_FLMN	1250	1348	7.23e-34	SMART
IG_FLMN	1350	1441	2.04e-42	SMART
IG_FLMN	1443	1537	1.75e-41	SMART
IG_FLMN	1539	1634	1.31e-40	SMART
IG_FLMN	1636	1738	6.11e-32	SMART
IG_FLMN	1744	1825	2.93e-11	SMART
IG_FLMN	1826	1917	2.55e-43	SMART
IG_FLMN	1918	2004	2.43e-17	SMART
IG_FLMN	2008	2099	1.52e-41	SMART
PDB:2E9I\|A	2100	2129	3e-7	PDB
IG_FLMN	2184	2277	2.93e-11	SMART
IG_FLMN	2281	2372	1.67e-38	SMART
IG_FLMN	2375	2467	2.56e-25	SMART
IG_FLMN	2472	2563	9.54e-34	SMART
low complexity region	2585	2595	N/A	INTRINSIC
IG_FLMN	2602	2704	2.11e-26	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three related filamin genes, specifically gamma filamin. These filamin proteins crosslink actin filaments into orthogonal networks in cortical cytoplasm and participate in the anchoring of membrane proteins for the actin cytoskeleton. Three functional domains exist in filamin: an N-terminal filamentous actin-binding domain, a C-terminal self-association domain, and a membrane glycoprotein-binding domain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic allele display neonatal lethality, respiratory failure, reduced skeletal muscle mass, and abnormal skeletal muscle fiber morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 27 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
B4galt4	T	C	16: 38,763,151	Y253H	probably damaging	Het
C330027C09Rik	T	A	16: 49,018,391	M857K	probably benign	Het
Catsperd	A	G	17: 56,628,231	R15G	unknown	Het
Cep350	G	A	1: 155,875,367	P2020S	probably benign	Het
Fancm	T	A	12: 65,105,540	D923E	possibly damaging	Het
Fastk	A	G	5: 24,445,069	S27P	probably benign	Het
Gfm2	T	C	13: 97,149,398	W132R	probably damaging	Het
Gm21119	A	T	8: 20,619,074	D148V	probably damaging	Het
Grhl1	T	C	12: 24,586,083	I348T	probably damaging	Het
Gstcd	G	T	3: 132,998,947	H515Q	probably damaging	Het
Igsf3	A	G	3: 101,431,309	Y313C	probably damaging	Het
Mbtd1	G	A	11: 93,908,938		probably null	Het
Myo9a	T	C	9: 59,905,907	S2130P	probably damaging	Het
Olfr139	A	T	11: 74,045,014	C87S	probably benign	Het
Plpp4	T	A	7: 129,323,487	F149I	probably benign	Het
Poglut1	T	C	16: 38,542,923	T165A	probably benign	Het
Rhbdf1	A	G	11: 32,213,101	I425T	probably benign	Het
Sf3a2	ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT	ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT	10: 80,804,437		probably benign	Het
Slc6a9	T	C	4: 117,857,406	S175P	probably benign	Het
Slitrk3	C	T	3: 73,048,794	G882S	probably benign	Het
Spag9	A	G	11: 94,071,583	I356M	probably damaging	Het
Spef2	A	T	15: 9,596,586	L1459Q	probably damaging	Het
Tenm3	A	T	8: 48,235,761	F2264I	possibly damaging	Het
Vmn2r3	T	C	3: 64,271,314	N510S	probably benign	Het
Zfp866	A	T	8: 69,766,638	C111S	probably damaging	Het
Zfp971	T	A	2: 178,033,510	C301S	probably damaging	Het
Zfp976	T	C	7: 42,612,617	T600A	unknown	Het

Other mutations in Flnc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Flnc	APN	6	29459547	nonsense	probably null
IGL01099:Flnc	APN	6	29433618	missense	probably damaging	0.99
IGL01656:Flnc	APN	6	29443508	splice site	probably benign
IGL01659:Flnc	APN	6	29448671	missense	probably damaging	0.98
IGL01780:Flnc	APN	6	29438493	nonsense	probably null
IGL01935:Flnc	APN	6	29454280	missense	probably damaging	1.00
IGL02039:Flnc	APN	6	29450719	missense	probably benign	0.05
IGL02119:Flnc	APN	6	29447512	missense	probably damaging	0.98
IGL02122:Flnc	APN	6	29444336	missense	possibly damaging	0.70
IGL02236:Flnc	APN	6	29454376	missense	probably damaging	1.00
IGL02350:Flnc	APN	6	29438493	nonsense	probably null
IGL02357:Flnc	APN	6	29438493	nonsense	probably null
IGL02428:Flnc	APN	6	29451485	missense	probably damaging	1.00
IGL02496:Flnc	APN	6	29440685	missense	probably damaging	0.98
IGL02516:Flnc	APN	6	29450841	missense	probably damaging	0.99
IGL02696:Flnc	APN	6	29446698	missense	probably damaging	0.98
IGL03165:Flnc	APN	6	29449378	missense	probably damaging	1.00
IGL03190:Flnc	APN	6	29445637	splice site	probably benign
I1329:Flnc	UTSW	6	29451415	missense	probably damaging	1.00
R0111:Flnc	UTSW	6	29454340	missense	probably damaging	0.99
R0665:Flnc	UTSW	6	29455531	missense	probably damaging	1.00
R0748:Flnc	UTSW	6	29446344	missense	probably damaging	0.99
R0960:Flnc	UTSW	6	29441512	missense	probably damaging	1.00
R1328:Flnc	UTSW	6	29438613	missense	probably damaging	1.00
R1502:Flnc	UTSW	6	29438694	missense	probably benign	0.45
R1544:Flnc	UTSW	6	29444080	missense	probably benign	0.00
R1565:Flnc	UTSW	6	29455171	missense	probably damaging	1.00
R1640:Flnc	UTSW	6	29433807	missense	possibly damaging	0.78
R1691:Flnc	UTSW	6	29441214	missense	probably benign	0.09
R1818:Flnc	UTSW	6	29457448	missense	probably damaging	1.00
R1826:Flnc	UTSW	6	29455185	missense	probably damaging	0.99
R1851:Flnc	UTSW	6	29443479	missense	probably damaging	1.00
R1898:Flnc	UTSW	6	29438666	nonsense	probably null
R1905:Flnc	UTSW	6	29459460	missense	probably damaging	1.00
R1985:Flnc	UTSW	6	29444416	splice site	probably benign
R2016:Flnc	UTSW	6	29443797	critical splice donor site	probably null
R2017:Flnc	UTSW	6	29443797	critical splice donor site	probably null
R2020:Flnc	UTSW	6	29444363	missense	probably damaging	0.97
R2104:Flnc	UTSW	6	29450735	critical splice donor site	probably null
R2132:Flnc	UTSW	6	29443676	missense	probably damaging	1.00
R2141:Flnc	UTSW	6	29448675	missense	probably damaging	1.00
R2197:Flnc	UTSW	6	29459135	missense	probably damaging	1.00
R2202:Flnc	UTSW	6	29459508	missense	probably damaging	1.00
R2203:Flnc	UTSW	6	29459508	missense	probably damaging	1.00
R2204:Flnc	UTSW	6	29459508	missense	probably damaging	1.00
R2205:Flnc	UTSW	6	29459508	missense	probably damaging	1.00
R2209:Flnc	UTSW	6	29455845	missense	possibly damaging	0.91
R2248:Flnc	UTSW	6	29451401	missense	probably damaging	0.99
R2258:Flnc	UTSW	6	29438666	nonsense	probably null
R2259:Flnc	UTSW	6	29438666	nonsense	probably null
R2280:Flnc	UTSW	6	29438666	nonsense	probably null
R2281:Flnc	UTSW	6	29438666	nonsense	probably null
R2873:Flnc	UTSW	6	29447543	missense	probably damaging	0.96
R2900:Flnc	UTSW	6	29448585	missense	probably damaging	0.98
R3788:Flnc	UTSW	6	29454057	missense	probably damaging	0.99
R3799:Flnc	UTSW	6	29443739	missense	probably damaging	1.00
R3801:Flnc	UTSW	6	29447404	missense	probably damaging	0.98
R3851:Flnc	UTSW	6	29453719	missense	probably damaging	1.00
R3910:Flnc	UTSW	6	29459427	missense	probably damaging	1.00
R3982:Flnc	UTSW	6	29442941	missense	probably damaging	1.00
R3983:Flnc	UTSW	6	29442941	missense	probably damaging	1.00
R4023:Flnc	UTSW	6	29451635	missense	possibly damaging	0.95
R4676:Flnc	UTSW	6	29445154	splice site	probably null
R4694:Flnc	UTSW	6	29443448	missense	probably damaging	1.00
R4695:Flnc	UTSW	6	29440429	missense	probably damaging	0.99
R4735:Flnc	UTSW	6	29455813	missense	probably damaging	1.00
R4773:Flnc	UTSW	6	29445039	missense	possibly damaging	0.96
R4828:Flnc	UTSW	6	29455167	missense	probably damaging	1.00
R4856:Flnc	UTSW	6	29447890	missense	probably damaging	1.00
R4879:Flnc	UTSW	6	29460806	missense	probably damaging	0.99
R4899:Flnc	UTSW	6	29446843	missense	probably benign	0.17
R4906:Flnc	UTSW	6	29447525	missense	probably damaging	0.99
R5089:Flnc	UTSW	6	29447813	missense	probably damaging	0.96
R5173:Flnc	UTSW	6	29455538	missense	probably damaging	1.00
R5174:Flnc	UTSW	6	29448894	missense	possibly damaging	0.91
R5290:Flnc	UTSW	6	29457554	missense	probably damaging	1.00
R5338:Flnc	UTSW	6	29444064	missense	possibly damaging	0.47
R5352:Flnc	UTSW	6	29449318	missense	possibly damaging	0.85
R5397:Flnc	UTSW	6	29441161	missense	possibly damaging	0.87
R5431:Flnc	UTSW	6	29456384	missense	possibly damaging	0.74
R5481:Flnc	UTSW	6	29441217	missense	probably damaging	1.00
R5511:Flnc	UTSW	6	29458898	missense	probably damaging	1.00
R5539:Flnc	UTSW	6	29446230	missense	probably damaging	1.00
R5549:Flnc	UTSW	6	29453691	missense	probably damaging	1.00
R5567:Flnc	UTSW	6	29444045	nonsense	probably null
R5584:Flnc	UTSW	6	29446628	missense	probably damaging	0.98
R5689:Flnc	UTSW	6	29441592	missense	probably benign	0.03
R5753:Flnc	UTSW	6	29433489	missense	probably benign
R5786:Flnc	UTSW	6	29459537	nonsense	probably null
R5822:Flnc	UTSW	6	29459430	missense	probably damaging	0.98
R5823:Flnc	UTSW	6	29461202	missense	probably damaging	0.99
R5933:Flnc	UTSW	6	29441106	missense	probably damaging	0.99
R6043:Flnc	UTSW	6	29446608	missense	probably damaging	1.00
R6320:Flnc	UTSW	6	29459063	missense	probably damaging	1.00
R6337:Flnc	UTSW	6	29454319	missense	probably damaging	0.99
R6399:Flnc	UTSW	6	29458883	missense	probably damaging	1.00
R6423:Flnc	UTSW	6	29445156	splice site	probably null
R6540:Flnc	UTSW	6	29446377	missense	possibly damaging	0.96
R6547:Flnc	UTSW	6	29448608	missense	probably damaging	0.98
R6717:Flnc	UTSW	6	29450902	small deletion	probably benign
R6875:Flnc	UTSW	6	29445749	missense	probably damaging	1.00
R7193:Flnc	UTSW	6	29450871	missense	probably damaging	1.00
R7255:Flnc	UTSW	6	29445766	missense	probably damaging	1.00
R7303:Flnc	UTSW	6	29460850	missense	probably benign	0.31
R7413:Flnc	UTSW	6	29452259	missense	probably damaging	1.00
R7422:Flnc	UTSW	6	29455471	missense	probably damaging	1.00
R7559:Flnc	UTSW	6	29459010	missense	probably damaging	1.00
R7632:Flnc	UTSW	6	29446985	missense	probably damaging	0.98
R7651:Flnc	UTSW	6	29444050	missense	probably benign	0.08
R7679:Flnc	UTSW	6	29456790	missense	probably benign	0.00
R7697:Flnc	UTSW	6	29456517	missense	probably damaging	0.98
R7788:Flnc	UTSW	6	29456444	missense	possibly damaging	0.67
R7852:Flnc	UTSW	6	29440898	missense	probably damaging	1.00
R7870:Flnc	UTSW	6	29454307	missense	probably damaging	1.00
R7873:Flnc	UTSW	6	29456991	missense	possibly damaging	0.88
R7921:Flnc	UTSW	6	29447770	missense	possibly damaging	0.58
R7950:Flnc	UTSW	6	29456382	missense	possibly damaging	0.61
R7953:Flnc	UTSW	6	29447829	missense	probably damaging	0.99
R7970:Flnc	UTSW	6	29447526	missense	possibly damaging	0.96
R8071:Flnc	UTSW	6	29457446	missense	probably damaging	1.00
R8143:Flnc	UTSW	6	29441485	missense	probably benign	0.20
R8166:Flnc	UTSW	6	29433732	missense	probably damaging	0.99
R8167:Flnc	UTSW	6	29455922	missense	probably damaging	0.98
R8306:Flnc	UTSW	6	29449370	missense	probably benign	0.05
R8428:Flnc	UTSW	6	29450850	missense	probably benign	0.36
R8466:Flnc	UTSW	6	29438622	missense	probably damaging	0.98
R8671:Flnc	UTSW	6	29443502	critical splice donor site	probably null
R8885:Flnc	UTSW	6	29455411	missense	probably damaging	0.96
R8922:Flnc	UTSW	6	29456836	missense	probably damaging	0.99
R8923:Flnc	UTSW	6	29452237	missense	probably damaging	1.00
R8985:Flnc	UTSW	6	29440500	missense	probably benign	0.37
R9075:Flnc	UTSW	6	29447647	missense	probably damaging	0.96
R9098:Flnc	UTSW	6	29455519	nonsense	probably null
R9162:Flnc	UTSW	6	29455861	missense	probably damaging	1.00
R9199:Flnc	UTSW	6	29441491	missense	probably benign	0.31
R9204:Flnc	UTSW	6	29452354	missense	possibly damaging	0.93
R9273:Flnc	UTSW	6	29447816	missense	probably benign	0.08
R9411:Flnc	UTSW	6	29441485	missense	probably benign
R9412:Flnc	UTSW	6	29441485	missense	probably benign
R9413:Flnc	UTSW	6	29441485	missense	probably benign
R9451:Flnc	UTSW	6	29445463	missense	probably damaging	0.98
R9524:Flnc	UTSW	6	29461110	missense	probably damaging	1.00
R9582:Flnc	UTSW	6	29460737	missense	probably damaging	0.99
R9595:Flnc	UTSW	6	29433721	missense	probably benign	0.05
R9664:Flnc	UTSW	6	29457215	missense	probably damaging	1.00
R9665:Flnc	UTSW	6	29455448	missense	probably damaging	1.00
R9686:Flnc	UTSW	6	29456435	missense	possibly damaging	0.84
Z1088:Flnc	UTSW	6	29457151	missense	probably damaging	1.00
Z1177:Flnc	UTSW	6	29447545	missense	probably damaging	1.00
Z1177:Flnc	UTSW	6	29457130	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGTCACCAAGGATGCTGGG -3'
(R):5'- GCTCTGGAGAACAACATCCTC -3'

Sequencing Primer
(F):5'- GGCACAAGGATAGACCCTCTG -3'
(R):5'- TGGAGAACAACATCCTCACATTTATC -3'

Posted On

2022-08-09