Incidental Mutation 'R9576:Ccdc150'
ID 722258
Institutional Source Beutler Lab
Gene Symbol Ccdc150
Ensembl Gene ENSMUSG00000025983
Gene Name coiled-coil domain containing 150
Synonyms 4930511H11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R9576 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 54250683-54368727 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 54368385 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 1107 (E1107*)
Ref Sequence ENSEMBL: ENSMUSP00000027128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027128] [ENSMUST00000160472]
AlphaFold Q8CDI7
Predicted Effect probably null
Transcript: ENSMUST00000027128
AA Change: E1107*
SMART Domains Protein: ENSMUSP00000027128
Gene: ENSMUSG00000025983
AA Change: E1107*

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 676 N/A INTRINSIC
coiled coil region 727 952 N/A INTRINSIC
coiled coil region 985 1048 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160472
SMART Domains Protein: ENSMUSP00000125195
Gene: ENSMUSG00000025983

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,063,642 I580N probably benign Het
Aars T A 8: 111,041,664 Y222* probably null Het
Abi2 G T 1: 60,409,849 R16L possibly damaging Het
Adam9 C A 8: 24,955,937 V814F probably benign Het
Adgrv1 T C 13: 81,543,489 T1660A probably benign Het
Aipl1 C T 11: 72,037,427 G11D probably damaging Het
Arhgap26 T A 18: 39,120,154 Y211* probably null Het
Ascc3 T C 10: 50,618,158 Y230H possibly damaging Het
Btg4 C A 9: 51,119,136 Q179K probably damaging Het
Ccdc88c T C 12: 100,945,490 D695G possibly damaging Het
Cd200r4 A G 16: 44,837,975 T241A Het
Chd9 T A 8: 90,932,666 S85T unknown Het
Cltc G A 11: 86,702,411 S1542F probably benign Het
Col6a4 C A 9: 106,068,072 A948S probably benign Het
Crygb T C 1: 65,080,527 D98G probably benign Het
Ctbp2 A T 7: 133,014,469 S246T probably benign Het
Dcp1b T A 6: 119,220,032 Y563* probably null Het
Ddx59 T A 1: 136,416,943 Y117* probably null Het
Dhx30 A G 9: 110,087,644 L601P probably damaging Het
Dnah5 C T 15: 28,272,140 T1030M probably benign Het
Dpp10 A G 1: 123,341,680 S667P probably damaging Het
Epha7 G A 4: 28,870,659 C312Y probably damaging Het
Gbf1 A T 19: 46,259,683 T300S probably benign Het
Glp2r T C 11: 67,764,796 K40R probably benign Het
H2-Q5 G A 17: 35,394,437 V49M Het
Havcr1 T A 11: 46,778,564 V290E probably benign Het
Hc T A 2: 34,983,755 T1656S probably benign Het
Hfm1 A T 5: 106,874,072 I999N probably benign Het
Hoxc4 A T 15: 103,035,958 E254V probably benign Het
Il5ra T C 6: 106,735,727 N275S probably damaging Het
Itfg2 C A 6: 128,412,987 A272S probably benign Het
Itpr2 A T 6: 146,311,007 I1537N probably damaging Het
Jakmip3 A G 7: 139,020,259 E296G probably damaging Het
Jchain T G 5: 88,526,117 E56A probably damaging Het
Kcnh5 A T 12: 74,897,533 S981T probably benign Het
Kcnk2 CAAA CAA 1: 189,256,694 probably null Het
Klk1b4 A T 7: 44,211,053 D165V probably benign Het
Krt2 T A 15: 101,811,357 Y626F unknown Het
Lrrk2 T A 15: 91,752,185 L1454* probably null Het
Myb C T 10: 21,154,713 D62N probably benign Het
Myo18a T A 11: 77,819,001 I607N probably damaging Het
Nefh C T 11: 4,941,222 E466K possibly damaging Het
Nudc T C 4: 133,535,678 E118G probably benign Het
Olfr171 A T 16: 19,624,211 D296E probably damaging Het
Olfr679 T C 7: 105,086,553 L279S probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Per1 T A 11: 69,108,029 M1142K probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Plec C A 15: 76,231,177 A66S probably benign Het
Plekha7 T C 7: 116,129,434 Y1199C possibly damaging Het
Pou2f2 C A 7: 25,097,144 A302S probably benign Het
Prkag3 A T 1: 74,747,923 W59R Het
Rin3 T A 12: 102,369,330 L420* probably null Het
Sash1 T A 10: 8,744,535 M454L probably benign Het
Serpina3i A G 12: 104,268,471 T354A probably benign Het
Skap1 T C 11: 96,581,204 F101S probably benign Het
Slc16a8 T A 15: 79,251,982 Q340L probably damaging Het
Slc2a12 A T 10: 22,702,105 Q600L possibly damaging Het
Slc39a14 T G 14: 70,318,786 D47A probably benign Het
Slfn9 T A 11: 82,987,385 Y306F possibly damaging Het
Sos1 T C 17: 80,434,938 M387V probably benign Het
Srl A T 16: 4,483,167 L680Q probably damaging Het
Tas1r3 C T 4: 155,862,365 R261H probably benign Het
Tm7sf3 C A 6: 146,609,837 G385W probably damaging Het
Tmem191c C T 16: 17,276,662 R62* probably null Het
Triobp T C 15: 78,960,066 S161P probably damaging Het
Usp13 A T 3: 32,914,986 probably null Het
Vipr1 G A 9: 121,642,927 probably null Het
Vmn1r230 C A 17: 20,846,901 C117* probably null Het
Vmn2r50 T C 7: 10,037,263 Q837R probably benign Het
Zfp618 T C 4: 63,133,045 S688P probably benign Het
Other mutations in Ccdc150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Ccdc150 APN 1 54272550 splice site probably benign
IGL00819:Ccdc150 APN 1 54263573 missense probably damaging 1.00
IGL01973:Ccdc150 APN 1 54300488 splice site probably null
IGL02352:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02359:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02620:Ccdc150 APN 1 54263545 nonsense probably null
IGL02673:Ccdc150 APN 1 54328990 missense probably benign 0.09
IGL03148:Ccdc150 APN 1 54278715 missense possibly damaging 0.68
IGL03185:Ccdc150 APN 1 54300323 missense probably damaging 1.00
IGL03014:Ccdc150 UTSW 1 54290702 missense probably damaging 0.99
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0217:Ccdc150 UTSW 1 54300430 missense possibly damaging 0.87
R0582:Ccdc150 UTSW 1 54329511 missense probably benign
R0687:Ccdc150 UTSW 1 54285631 splice site probably null
R0790:Ccdc150 UTSW 1 54277776 splice site probably benign
R1146:Ccdc150 UTSW 1 54364971 splice site probably benign
R1288:Ccdc150 UTSW 1 54364458 missense probably damaging 1.00
R1763:Ccdc150 UTSW 1 54354636 missense probably benign 0.42
R1855:Ccdc150 UTSW 1 54367910 intron probably benign
R1957:Ccdc150 UTSW 1 54263909 missense probably benign 0.00
R2180:Ccdc150 UTSW 1 54272547 critical splice donor site probably null
R2226:Ccdc150 UTSW 1 54364925 missense probably null 0.11
R3054:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3055:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3056:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3409:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R3411:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R3812:Ccdc150 UTSW 1 54368310 missense probably benign 0.00
R4031:Ccdc150 UTSW 1 54278811 missense probably benign 0.31
R4356:Ccdc150 UTSW 1 54353054 missense probably damaging 0.98
R4617:Ccdc150 UTSW 1 54355754 missense probably benign 0.00
R4757:Ccdc150 UTSW 1 54278715 missense possibly damaging 0.81
R4957:Ccdc150 UTSW 1 54364868 intron probably benign
R5028:Ccdc150 UTSW 1 54263477 missense probably benign 0.01
R5512:Ccdc150 UTSW 1 54354647 missense probably damaging 0.96
R5757:Ccdc150 UTSW 1 54263620 missense probably damaging 1.00
R5943:Ccdc150 UTSW 1 54300367 missense probably benign 0.01
R5948:Ccdc150 UTSW 1 54277714 missense possibly damaging 0.79
R6033:Ccdc150 UTSW 1 54285628 critical splice donor site probably null
R6033:Ccdc150 UTSW 1 54285628 critical splice donor site probably null
R6065:Ccdc150 UTSW 1 54263599 missense possibly damaging 0.90
R6390:Ccdc150 UTSW 1 54368017 missense probably benign 0.01
R6399:Ccdc150 UTSW 1 54263957 splice site probably null
R6988:Ccdc150 UTSW 1 54355709 nonsense probably null
R7248:Ccdc150 UTSW 1 54304898 missense probably benign 0.00
R7319:Ccdc150 UTSW 1 54263337 splice site probably null
R7322:Ccdc150 UTSW 1 54259966 missense probably benign 0.01
R7366:Ccdc150 UTSW 1 54300382 nonsense probably null
R7647:Ccdc150 UTSW 1 54356704 missense probably damaging 1.00
R7981:Ccdc150 UTSW 1 54368392 missense probably damaging 1.00
R8002:Ccdc150 UTSW 1 54272497 missense probably damaging 0.99
R8201:Ccdc150 UTSW 1 54329487 missense probably benign 0.10
R8688:Ccdc150 UTSW 1 54367973 missense probably damaging 1.00
R8719:Ccdc150 UTSW 1 54263509 missense probably benign 0.00
R8963:Ccdc150 UTSW 1 54272482 missense probably benign 0.14
R9178:Ccdc150 UTSW 1 54272485 missense probably damaging 0.99
R9200:Ccdc150 UTSW 1 54260038 missense probably damaging 1.00
R9332:Ccdc150 UTSW 1 54277751 missense probably damaging 0.99
R9367:Ccdc150 UTSW 1 54285601 missense probably damaging 1.00
R9416:Ccdc150 UTSW 1 54278831 missense probably damaging 0.97
R9430:Ccdc150 UTSW 1 54281771 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCGACAACTGCTGGGAAAC -3'
(R):5'- ACAAAGAGATGGGTTGGTTCTG -3'

Sequencing Primer
(F):5'- CACCTTTCCCAAACTATGTAGATC -3'
(R):5'- GGTTCTGCAGTAATAGAAAAGAGTTC -3'
Posted On 2022-08-09