Incidental Mutation 'R9576:Dpp10'
ID 722262
Institutional Source Beutler Lab
Gene Symbol Dpp10
Ensembl Gene ENSMUSG00000036815
Gene Name dipeptidylpeptidase 10
Synonyms 6430601K09Rik, DPRP3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9576 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 123321471-124045559 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 123341680 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 667 (S667P)
Ref Sequence ENSEMBL: ENSMUSP00000108225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000112603
AA Change: S656P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: S656P

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:DPPIV_N 83 450 4.9e-118 PFAM
Pfam:Peptidase_S9 530 734 6.4e-47 PFAM
Pfam:DLH 556 711 1.4e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112606
AA Change: S667P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: S667P

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:DPPIV_N 137 504 4.4e-115 PFAM
Pfam:Peptidase_S9 584 788 8.6e-48 PFAM
Pfam:DLH 604 774 1.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,063,642 I580N probably benign Het
Aars T A 8: 111,041,664 Y222* probably null Het
Abi2 G T 1: 60,409,849 R16L possibly damaging Het
Adam9 C A 8: 24,955,937 V814F probably benign Het
Adgrv1 T C 13: 81,543,489 T1660A probably benign Het
Aipl1 C T 11: 72,037,427 G11D probably damaging Het
Arhgap26 T A 18: 39,120,154 Y211* probably null Het
Ascc3 T C 10: 50,618,158 Y230H possibly damaging Het
Btg4 C A 9: 51,119,136 Q179K probably damaging Het
Ccdc150 G T 1: 54,368,385 E1107* probably null Het
Ccdc88c T C 12: 100,945,490 D695G possibly damaging Het
Cd200r4 A G 16: 44,837,975 T241A Het
Chd9 T A 8: 90,932,666 S85T unknown Het
Cltc G A 11: 86,702,411 S1542F probably benign Het
Col6a4 C A 9: 106,068,072 A948S probably benign Het
Crygb T C 1: 65,080,527 D98G probably benign Het
Ctbp2 A T 7: 133,014,469 S246T probably benign Het
Dcp1b T A 6: 119,220,032 Y563* probably null Het
Ddx59 T A 1: 136,416,943 Y117* probably null Het
Dhx30 A G 9: 110,087,644 L601P probably damaging Het
Dnah5 C T 15: 28,272,140 T1030M probably benign Het
Epha7 G A 4: 28,870,659 C312Y probably damaging Het
Gbf1 A T 19: 46,259,683 T300S probably benign Het
Glp2r T C 11: 67,764,796 K40R probably benign Het
H2-Q5 G A 17: 35,394,437 V49M Het
Havcr1 T A 11: 46,778,564 V290E probably benign Het
Hc T A 2: 34,983,755 T1656S probably benign Het
Hfm1 A T 5: 106,874,072 I999N probably benign Het
Hoxc4 A T 15: 103,035,958 E254V probably benign Het
Il5ra T C 6: 106,735,727 N275S probably damaging Het
Itfg2 C A 6: 128,412,987 A272S probably benign Het
Itpr2 A T 6: 146,311,007 I1537N probably damaging Het
Jakmip3 A G 7: 139,020,259 E296G probably damaging Het
Jchain T G 5: 88,526,117 E56A probably damaging Het
Kcnh5 A T 12: 74,897,533 S981T probably benign Het
Kcnk2 CAAA CAA 1: 189,256,694 probably null Het
Klk1b4 A T 7: 44,211,053 D165V probably benign Het
Krt2 T A 15: 101,811,357 Y626F unknown Het
Lrrk2 T A 15: 91,752,185 L1454* probably null Het
Myb C T 10: 21,154,713 D62N probably benign Het
Myo18a T A 11: 77,819,001 I607N probably damaging Het
Nefh C T 11: 4,941,222 E466K possibly damaging Het
Nudc T C 4: 133,535,678 E118G probably benign Het
Olfr171 A T 16: 19,624,211 D296E probably damaging Het
Olfr679 T C 7: 105,086,553 L279S probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Per1 T A 11: 69,108,029 M1142K probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Plec C A 15: 76,231,177 A66S probably benign Het
Plekha7 T C 7: 116,129,434 Y1199C possibly damaging Het
Pou2f2 C A 7: 25,097,144 A302S probably benign Het
Prkag3 A T 1: 74,747,923 W59R Het
Rin3 T A 12: 102,369,330 L420* probably null Het
Sash1 T A 10: 8,744,535 M454L probably benign Het
Serpina3i A G 12: 104,268,471 T354A probably benign Het
Skap1 T C 11: 96,581,204 F101S probably benign Het
Slc16a8 T A 15: 79,251,982 Q340L probably damaging Het
Slc2a12 A T 10: 22,702,105 Q600L possibly damaging Het
Slc39a14 T G 14: 70,318,786 D47A probably benign Het
Slfn9 T A 11: 82,987,385 Y306F possibly damaging Het
Sos1 T C 17: 80,434,938 M387V probably benign Het
Srl A T 16: 4,483,167 L680Q probably damaging Het
Tas1r3 C T 4: 155,862,365 R261H probably benign Het
Tm7sf3 C A 6: 146,609,837 G385W probably damaging Het
Tmem191c C T 16: 17,276,662 R62* probably null Het
Triobp T C 15: 78,960,066 S161P probably damaging Het
Usp13 A T 3: 32,914,986 probably null Het
Vipr1 G A 9: 121,642,927 probably null Het
Vmn1r230 C A 17: 20,846,901 C117* probably null Het
Vmn2r50 T C 7: 10,037,263 Q837R probably benign Het
Zfp618 T C 4: 63,133,045 S688P probably benign Het
Other mutations in Dpp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Dpp10 APN 1 123334370 missense probably damaging 1.00
IGL01618:Dpp10 APN 1 123367867 missense probably benign
IGL02101:Dpp10 APN 1 123411826 missense probably damaging 1.00
IGL02284:Dpp10 APN 1 124045366 splice site probably benign
IGL02324:Dpp10 APN 1 123367802 missense probably benign 0.02
IGL02391:Dpp10 APN 1 123650358 missense probably damaging 0.98
IGL02458:Dpp10 APN 1 123341689 missense probably benign 0.01
IGL02469:Dpp10 APN 1 123411803 missense probably benign 0.01
IGL02501:Dpp10 APN 1 123686270 missense possibly damaging 0.93
IGL02522:Dpp10 APN 1 123423652 missense probably benign 0.24
IGL02672:Dpp10 APN 1 123376647 missense probably benign 0.45
IGL03034:Dpp10 APN 1 123341619 missense probably damaging 1.00
PIT1430001:Dpp10 UTSW 1 123341182 splice site probably benign
R0104:Dpp10 UTSW 1 123367843 missense probably benign 0.00
R0114:Dpp10 UTSW 1 123486092 missense probably benign 0.07
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0682:Dpp10 UTSW 1 123905125 missense probably damaging 0.98
R0815:Dpp10 UTSW 1 123432929 critical splice donor site probably null
R1549:Dpp10 UTSW 1 123341380 critical splice acceptor site probably null
R1742:Dpp10 UTSW 1 123445206 missense probably damaging 1.00
R1859:Dpp10 UTSW 1 123353604 missense possibly damaging 0.47
R1991:Dpp10 UTSW 1 123905106 missense probably null 1.00
R1992:Dpp10 UTSW 1 123905106 missense probably null 1.00
R2079:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
R2882:Dpp10 UTSW 1 123445203 missense probably damaging 1.00
R2974:Dpp10 UTSW 1 123411705 splice site probably benign
R3827:Dpp10 UTSW 1 123411790 missense possibly damaging 0.56
R3852:Dpp10 UTSW 1 123485924 nonsense probably null
R3876:Dpp10 UTSW 1 123353487 missense probably damaging 0.98
R3899:Dpp10 UTSW 1 123353557 missense probably damaging 1.00
R4735:Dpp10 UTSW 1 123398627 missense probably benign 0.15
R4922:Dpp10 UTSW 1 123378153 missense probably benign 0.44
R5457:Dpp10 UTSW 1 123411810 missense possibly damaging 0.51
R5599:Dpp10 UTSW 1 123905076 missense probably damaging 0.99
R5913:Dpp10 UTSW 1 123384289 missense probably damaging 1.00
R5979:Dpp10 UTSW 1 123384283 critical splice donor site probably null
R6378:Dpp10 UTSW 1 123411739 missense probably damaging 1.00
R6429:Dpp10 UTSW 1 123367601 missense possibly damaging 0.72
R6505:Dpp10 UTSW 1 123336851 missense probably damaging 0.99
R6776:Dpp10 UTSW 1 123367656 nonsense probably null
R6894:Dpp10 UTSW 1 123336864 missense probably damaging 1.00
R6951:Dpp10 UTSW 1 123341650 missense possibly damaging 0.93
R7182:Dpp10 UTSW 1 123341151 missense probably benign 0.15
R7246:Dpp10 UTSW 1 123334377 missense probably damaging 1.00
R7297:Dpp10 UTSW 1 123353428 nonsense probably null
R7375:Dpp10 UTSW 1 123367795 missense probably benign
R7387:Dpp10 UTSW 1 123341140 missense probably benign 0.01
R7661:Dpp10 UTSW 1 123384952 missense probably damaging 1.00
R8065:Dpp10 UTSW 1 123352660 missense probably benign
R8067:Dpp10 UTSW 1 123352660 missense probably benign
R8260:Dpp10 UTSW 1 123686295 missense probably benign
R8324:Dpp10 UTSW 1 123854172 missense probably benign 0.02
R8373:Dpp10 UTSW 1 123854229 missense possibly damaging 0.94
R8434:Dpp10 UTSW 1 123433010 missense probably damaging 1.00
R9068:Dpp10 UTSW 1 123432938 missense probably damaging 1.00
R9104:Dpp10 UTSW 1 123411755 missense probably damaging 1.00
R9477:Dpp10 UTSW 1 123376641 missense possibly damaging 0.46
R9492:Dpp10 UTSW 1 123353430 missense probably damaging 1.00
R9524:Dpp10 UTSW 1 123336882 missense probably damaging 1.00
R9631:Dpp10 UTSW 1 123341703 missense probably damaging 1.00
R9736:Dpp10 UTSW 1 123334359 missense possibly damaging 0.64
X0019:Dpp10 UTSW 1 123398585 missense possibly damaging 0.88
X0020:Dpp10 UTSW 1 123398582 missense probably benign 0.36
X0021:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
X0024:Dpp10 UTSW 1 123384286 missense probably damaging 1.00
Z1176:Dpp10 UTSW 1 123353440 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCACGCTCCAGTAAAATCAATTG -3'
(R):5'- TGGAGCAATTCTAGGATACATGGTG -3'

Sequencing Primer
(F):5'- CAATTGCATAAAGGAGGTGATAACTC -3'
(R):5'- GAGATATTGGAACATGTGCA -3'
Posted On 2022-08-09