Incidental Mutation 'R9576:Triobp'
ID 722315
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene Name TRIO and F-actin binding protein
Synonyms EST478828, Mus EST 478828, Tara
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9576 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 78831924-78890069 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78844266 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 161 (S161P)
Ref Sequence ENSEMBL: ENSMUSP00000105312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000140228] [ENSMUST00000229943]
AlphaFold Q99KW3
Predicted Effect probably damaging
Transcript: ENSMUST00000109689
AA Change: S161P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: S161P

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109690
AA Change: S161P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: S161P

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140228
AA Change: S161P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000229943
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 81,947,843 (GRCm39) I580N probably benign Het
Aars1 T A 8: 111,768,296 (GRCm39) Y222* probably null Het
Abi2 G T 1: 60,449,008 (GRCm39) R16L possibly damaging Het
Adam9 C A 8: 25,445,953 (GRCm39) V814F probably benign Het
Adgrv1 T C 13: 81,691,608 (GRCm39) T1660A probably benign Het
Aipl1 C T 11: 71,928,253 (GRCm39) G11D probably damaging Het
Arhgap26 T A 18: 39,253,207 (GRCm39) Y211* probably null Het
Ascc3 T C 10: 50,494,254 (GRCm39) Y230H possibly damaging Het
Btg4 C A 9: 51,030,436 (GRCm39) Q179K probably damaging Het
Ccdc150 G T 1: 54,407,544 (GRCm39) E1107* probably null Het
Ccdc88c T C 12: 100,911,749 (GRCm39) D695G possibly damaging Het
Cd200r4 A G 16: 44,658,338 (GRCm39) T241A Het
Chd9 T A 8: 91,659,294 (GRCm39) S85T unknown Het
Cltc G A 11: 86,593,237 (GRCm39) S1542F probably benign Het
Col6a4 C A 9: 105,945,271 (GRCm39) A948S probably benign Het
Crygb T C 1: 65,119,686 (GRCm39) D98G probably benign Het
Ctbp2 A T 7: 132,616,198 (GRCm39) S246T probably benign Het
Dcp1b T A 6: 119,196,993 (GRCm39) Y563* probably null Het
Ddx59 T A 1: 136,344,681 (GRCm39) Y117* probably null Het
Dhx30 A G 9: 109,916,712 (GRCm39) L601P probably damaging Het
Dnah5 C T 15: 28,272,286 (GRCm39) T1030M probably benign Het
Dpp10 A G 1: 123,269,409 (GRCm39) S667P probably damaging Het
Epha7 G A 4: 28,870,659 (GRCm39) C312Y probably damaging Het
Gbf1 A T 19: 46,248,122 (GRCm39) T300S probably benign Het
Glp2r T C 11: 67,655,622 (GRCm39) K40R probably benign Het
H2-Q5 G A 17: 35,613,413 (GRCm39) V49M Het
Havcr1 T A 11: 46,669,391 (GRCm39) V290E probably benign Het
Hc T A 2: 34,873,767 (GRCm39) T1656S probably benign Het
Hfm1 A T 5: 107,021,938 (GRCm39) I999N probably benign Het
Hoxc4 A T 15: 102,944,384 (GRCm39) E254V probably benign Het
Il5ra T C 6: 106,712,688 (GRCm39) N275S probably damaging Het
Itfg2 C A 6: 128,389,950 (GRCm39) A272S probably benign Het
Itpr2 A T 6: 146,212,505 (GRCm39) I1537N probably damaging Het
Jakmip3 A G 7: 138,621,988 (GRCm39) E296G probably damaging Het
Jchain T G 5: 88,673,976 (GRCm39) E56A probably damaging Het
Kcnh5 A T 12: 74,944,307 (GRCm39) S981T probably benign Het
Kcnk2 CAAA CAA 1: 188,988,891 (GRCm39) probably null Het
Klk1b4 A T 7: 43,860,477 (GRCm39) D165V probably benign Het
Krt1c T A 15: 101,719,792 (GRCm39) Y626F unknown Het
Lrrk2 T A 15: 91,636,388 (GRCm39) L1454* probably null Het
Myb C T 10: 21,030,612 (GRCm39) D62N probably benign Het
Myo18a T A 11: 77,709,827 (GRCm39) I607N probably damaging Het
Nefh C T 11: 4,891,222 (GRCm39) E466K possibly damaging Het
Nudc T C 4: 133,262,989 (GRCm39) E118G probably benign Het
Or2aj6 A T 16: 19,442,961 (GRCm39) D296E probably damaging Het
Or56a3 T C 7: 104,735,760 (GRCm39) L279S probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Per1 T A 11: 68,998,855 (GRCm39) M1142K probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,302,525 (GRCm39) probably benign Het
Plec C A 15: 76,115,377 (GRCm39) A66S probably benign Het
Plekha7 T C 7: 115,728,669 (GRCm39) Y1199C possibly damaging Het
Pou2f2 C A 7: 24,796,569 (GRCm39) A302S probably benign Het
Prkag3 A T 1: 74,787,082 (GRCm39) W59R Het
Rin3 T A 12: 102,335,589 (GRCm39) L420* probably null Het
Sash1 T A 10: 8,620,299 (GRCm39) M454L probably benign Het
Serpina3i A G 12: 104,234,730 (GRCm39) T354A probably benign Het
Skap1 T C 11: 96,472,030 (GRCm39) F101S probably benign Het
Slc16a8 T A 15: 79,136,182 (GRCm39) Q340L probably damaging Het
Slc2a12 A T 10: 22,578,004 (GRCm39) Q600L possibly damaging Het
Slc39a14 T G 14: 70,556,235 (GRCm39) D47A probably benign Het
Slfn9 T A 11: 82,878,211 (GRCm39) Y306F possibly damaging Het
Sos1 T C 17: 80,742,367 (GRCm39) M387V probably benign Het
Srl A T 16: 4,301,031 (GRCm39) L680Q probably damaging Het
Tas1r3 C T 4: 155,946,822 (GRCm39) R261H probably benign Het
Tm7sf3 C A 6: 146,511,335 (GRCm39) G385W probably damaging Het
Tmem191 C T 16: 17,094,526 (GRCm39) R62* probably null Het
Usp13 A T 3: 32,969,135 (GRCm39) probably null Het
Vipr1 G A 9: 121,471,993 (GRCm39) probably null Het
Vmn1r230 C A 17: 21,067,163 (GRCm39) C117* probably null Het
Vmn2r50 T C 7: 9,771,190 (GRCm39) Q837R probably benign Het
Zfp618 T C 4: 63,051,282 (GRCm39) S688P probably benign Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78,877,568 (GRCm39) missense probably damaging 1.00
IGL01904:Triobp APN 15 78,851,564 (GRCm39) missense possibly damaging 0.80
IGL01957:Triobp APN 15 78,856,847 (GRCm39) critical splice donor site probably null
IGL02085:Triobp APN 15 78,858,497 (GRCm39) splice site probably benign
IGL02260:Triobp APN 15 78,850,562 (GRCm39) missense probably benign 0.00
IGL02498:Triobp APN 15 78,845,243 (GRCm39) missense probably benign 0.01
IGL02551:Triobp APN 15 78,857,689 (GRCm39) missense probably benign
IGL02740:Triobp APN 15 78,850,889 (GRCm39) missense probably benign 0.21
IGL02810:Triobp APN 15 78,886,403 (GRCm39) missense possibly damaging 0.95
IGL03063:Triobp APN 15 78,875,084 (GRCm39) missense probably damaging 1.00
FR4304:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
FR4340:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4342:Triobp UTSW 15 78,877,592 (GRCm39) unclassified probably benign
FR4449:Triobp UTSW 15 78,877,589 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
R0276:Triobp UTSW 15 78,857,876 (GRCm39) missense probably benign 0.09
R0309:Triobp UTSW 15 78,860,740 (GRCm39) missense probably damaging 1.00
R0433:Triobp UTSW 15 78,852,401 (GRCm39) missense possibly damaging 0.69
R0464:Triobp UTSW 15 78,851,186 (GRCm39) missense possibly damaging 0.71
R0525:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0665:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0689:Triobp UTSW 15 78,844,188 (GRCm39) nonsense probably null
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1151:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1152:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1510:Triobp UTSW 15 78,887,967 (GRCm39) missense probably damaging 1.00
R1519:Triobp UTSW 15 78,857,938 (GRCm39) missense probably benign 0.00
R1642:Triobp UTSW 15 78,886,348 (GRCm39) missense probably damaging 1.00
R1732:Triobp UTSW 15 78,851,428 (GRCm39) missense possibly damaging 0.69
R1755:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1975:Triobp UTSW 15 78,850,908 (GRCm39) missense probably benign
R2051:Triobp UTSW 15 78,888,740 (GRCm39) missense probably damaging 1.00
R2073:Triobp UTSW 15 78,858,095 (GRCm39) missense probably damaging 0.99
R2260:Triobp UTSW 15 78,875,640 (GRCm39) critical splice donor site probably null
R2351:Triobp UTSW 15 78,888,780 (GRCm39) missense probably benign 0.09
R2902:Triobp UTSW 15 78,857,618 (GRCm39) missense possibly damaging 0.90
R3801:Triobp UTSW 15 78,857,900 (GRCm39) missense probably benign 0.04
R3959:Triobp UTSW 15 78,886,589 (GRCm39) nonsense probably null
R4003:Triobp UTSW 15 78,844,177 (GRCm39) unclassified probably benign
R4084:Triobp UTSW 15 78,857,871 (GRCm39) missense probably benign 0.19
R4482:Triobp UTSW 15 78,850,763 (GRCm39) missense possibly damaging 0.87
R4592:Triobp UTSW 15 78,851,295 (GRCm39) missense probably benign
R4662:Triobp UTSW 15 78,877,469 (GRCm39) missense probably damaging 1.00
R4732:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4733:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4789:Triobp UTSW 15 78,875,228 (GRCm39) missense probably damaging 1.00
R4968:Triobp UTSW 15 78,850,816 (GRCm39) missense probably benign 0.03
R4990:Triobp UTSW 15 78,851,205 (GRCm39) missense probably benign 0.00
R5129:Triobp UTSW 15 78,845,296 (GRCm39) missense probably benign 0.15
R5181:Triobp UTSW 15 78,851,954 (GRCm39) missense probably benign 0.00
R5279:Triobp UTSW 15 78,878,591 (GRCm39) missense possibly damaging 0.66
R5584:Triobp UTSW 15 78,852,332 (GRCm39) missense possibly damaging 0.89
R5601:Triobp UTSW 15 78,857,833 (GRCm39) missense probably damaging 1.00
R5810:Triobp UTSW 15 78,852,467 (GRCm39) missense probably benign 0.07
R5969:Triobp UTSW 15 78,851,740 (GRCm39) missense probably benign 0.05
R6722:Triobp UTSW 15 78,885,765 (GRCm39) missense probably damaging 1.00
R6739:Triobp UTSW 15 78,850,566 (GRCm39) missense possibly damaging 0.77
R6810:Triobp UTSW 15 78,850,815 (GRCm39) missense possibly damaging 0.47
R7011:Triobp UTSW 15 78,862,923 (GRCm39) missense probably damaging 0.98
R7015:Triobp UTSW 15 78,878,260 (GRCm39) missense probably damaging 0.99
R7200:Triobp UTSW 15 78,851,042 (GRCm39) small deletion probably benign
R7294:Triobp UTSW 15 78,858,176 (GRCm39) missense probably damaging 0.99
R7688:Triobp UTSW 15 78,845,311 (GRCm39) splice site probably null
R7805:Triobp UTSW 15 78,858,204 (GRCm39) missense probably benign 0.37
R7972:Triobp UTSW 15 78,852,186 (GRCm39) missense probably damaging 1.00
R7977:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7987:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7999:Triobp UTSW 15 78,844,144 (GRCm39) missense probably damaging 0.99
R8344:Triobp UTSW 15 78,842,475 (GRCm39) missense possibly damaging 0.67
R8348:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8446:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8448:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8469:Triobp UTSW 15 78,851,219 (GRCm39) missense probably benign 0.00
R8491:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8492:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8493:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R9424:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9495:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9514:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9530:Triobp UTSW 15 78,886,321 (GRCm39) missense probably damaging 1.00
R9550:Triobp UTSW 15 78,858,077 (GRCm39) missense probably damaging 1.00
R9646:Triobp UTSW 15 78,887,934 (GRCm39) missense probably damaging 1.00
RF001:Triobp UTSW 15 78,851,227 (GRCm39) small insertion probably benign
RF005:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF007:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
RF022:Triobp UTSW 15 78,858,482 (GRCm39) missense probably benign 0.05
RF028:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF032:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF035:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF040:Triobp UTSW 15 78,851,263 (GRCm39) small insertion probably benign
RF049:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF051:Triobp UTSW 15 78,851,234 (GRCm39) small insertion probably benign
RF058:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
X0026:Triobp UTSW 15 78,844,223 (GRCm39) missense possibly damaging 0.94
Z1177:Triobp UTSW 15 78,886,381 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACACGCCCACATGTAGTAC -3'
(R):5'- AAGTCCCTATGCACTGAGCC -3'

Sequencing Primer
(F):5'- GAAGGGAAAGTCATTGATCTCTCTCC -3'
(R):5'- TATGCACTGAGCCCCACG -3'
Posted On 2022-08-09