Incidental Mutation 'R9576:Krt2'
ID 722319
Institutional Source Beutler Lab
Gene Symbol Krt2
Ensembl Gene ENSMUSG00000064201
Gene Name keratin 2
Synonyms Krt2-17, Krt2-2, Krt2e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock # R9576 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 101810689-101818169 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 101811357 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 626 (Y626F)
Ref Sequence ENSEMBL: ENSMUSP00000023712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023712]
AlphaFold Q3TTY5
Predicted Effect unknown
Transcript: ENSMUST00000023712
AA Change: Y626F
SMART Domains Protein: ENSMUSP00000023712
Gene: ENSMUSG00000064201
AA Change: Y626F

DomainStartEndE-ValueType
Pfam:Keratin_2_head 23 195 3.6e-26 PFAM
Filament 198 511 4.22e-152 SMART
low complexity region 520 533 N/A INTRINSIC
low complexity region 538 701 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: ENU-induced mutant mice exhibit scaly skin and increased pigmentation in the tail, ears and feet. Mice homozygous for a knock-out allele show scaly skin, acanthosis, hyperkeratosis, increased water loss, ear skin inflammation, and aberrant aggregation of keratin 10 in suprabasal epidermal keratinocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,063,642 I580N probably benign Het
Aars T A 8: 111,041,664 Y222* probably null Het
Abi2 G T 1: 60,409,849 R16L possibly damaging Het
Adam9 C A 8: 24,955,937 V814F probably benign Het
Adgrv1 T C 13: 81,543,489 T1660A probably benign Het
Aipl1 C T 11: 72,037,427 G11D probably damaging Het
Arhgap26 T A 18: 39,120,154 Y211* probably null Het
Ascc3 T C 10: 50,618,158 Y230H possibly damaging Het
Btg4 C A 9: 51,119,136 Q179K probably damaging Het
Ccdc150 G T 1: 54,368,385 E1107* probably null Het
Ccdc88c T C 12: 100,945,490 D695G possibly damaging Het
Cd200r4 A G 16: 44,837,975 T241A Het
Chd9 T A 8: 90,932,666 S85T unknown Het
Cltc G A 11: 86,702,411 S1542F probably benign Het
Col6a4 C A 9: 106,068,072 A948S probably benign Het
Crygb T C 1: 65,080,527 D98G probably benign Het
Ctbp2 A T 7: 133,014,469 S246T probably benign Het
Dcp1b T A 6: 119,220,032 Y563* probably null Het
Ddx59 T A 1: 136,416,943 Y117* probably null Het
Dhx30 A G 9: 110,087,644 L601P probably damaging Het
Dnah5 C T 15: 28,272,140 T1030M probably benign Het
Dpp10 A G 1: 123,341,680 S667P probably damaging Het
Epha7 G A 4: 28,870,659 C312Y probably damaging Het
Gbf1 A T 19: 46,259,683 T300S probably benign Het
Glp2r T C 11: 67,764,796 K40R probably benign Het
H2-Q5 G A 17: 35,394,437 V49M Het
Havcr1 T A 11: 46,778,564 V290E probably benign Het
Hc T A 2: 34,983,755 T1656S probably benign Het
Hfm1 A T 5: 106,874,072 I999N probably benign Het
Hoxc4 A T 15: 103,035,958 E254V probably benign Het
Il5ra T C 6: 106,735,727 N275S probably damaging Het
Itfg2 C A 6: 128,412,987 A272S probably benign Het
Itpr2 A T 6: 146,311,007 I1537N probably damaging Het
Jakmip3 A G 7: 139,020,259 E296G probably damaging Het
Jchain T G 5: 88,526,117 E56A probably damaging Het
Kcnh5 A T 12: 74,897,533 S981T probably benign Het
Kcnk2 CAAA CAA 1: 189,256,694 probably null Het
Klk1b4 A T 7: 44,211,053 D165V probably benign Het
Lrrk2 T A 15: 91,752,185 L1454* probably null Het
Myb C T 10: 21,154,713 D62N probably benign Het
Myo18a T A 11: 77,819,001 I607N probably damaging Het
Nefh C T 11: 4,941,222 E466K possibly damaging Het
Nudc T C 4: 133,535,678 E118G probably benign Het
Olfr171 A T 16: 19,624,211 D296E probably damaging Het
Olfr679 T C 7: 105,086,553 L279S probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Per1 T A 11: 69,108,029 M1142K probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Plec C A 15: 76,231,177 A66S probably benign Het
Plekha7 T C 7: 116,129,434 Y1199C possibly damaging Het
Pou2f2 C A 7: 25,097,144 A302S probably benign Het
Prkag3 A T 1: 74,747,923 W59R Het
Rin3 T A 12: 102,369,330 L420* probably null Het
Sash1 T A 10: 8,744,535 M454L probably benign Het
Serpina3i A G 12: 104,268,471 T354A probably benign Het
Skap1 T C 11: 96,581,204 F101S probably benign Het
Slc16a8 T A 15: 79,251,982 Q340L probably damaging Het
Slc2a12 A T 10: 22,702,105 Q600L possibly damaging Het
Slc39a14 T G 14: 70,318,786 D47A probably benign Het
Slfn9 T A 11: 82,987,385 Y306F possibly damaging Het
Sos1 T C 17: 80,434,938 M387V probably benign Het
Srl A T 16: 4,483,167 L680Q probably damaging Het
Tas1r3 C T 4: 155,862,365 R261H probably benign Het
Tm7sf3 C A 6: 146,609,837 G385W probably damaging Het
Tmem191c C T 16: 17,276,662 R62* probably null Het
Triobp T C 15: 78,960,066 S161P probably damaging Het
Usp13 A T 3: 32,914,986 probably null Het
Vipr1 G A 9: 121,642,927 probably null Het
Vmn1r230 C A 17: 20,846,901 C117* probably null Het
Vmn2r50 T C 7: 10,037,263 Q837R probably benign Het
Zfp618 T C 4: 63,133,045 S688P probably benign Het
Other mutations in Krt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Krt2 APN 15 101811211 missense probably benign 0.23
IGL01568:Krt2 APN 15 101813211 missense probably damaging 1.00
IGL01586:Krt2 APN 15 101811390 missense unknown
IGL01667:Krt2 APN 15 101816330 missense possibly damaging 0.85
IGL02017:Krt2 APN 15 101816504 missense probably damaging 1.00
IGL02022:Krt2 APN 15 101816518 missense probably damaging 1.00
IGL02538:Krt2 APN 15 101811154 missense unknown
IGL02959:Krt2 APN 15 101811328 missense unknown
IGL03295:Krt2 APN 15 101816429 missense probably damaging 0.99
R0195:Krt2 UTSW 15 101813191 nonsense probably null
R0472:Krt2 UTSW 15 101813253 missense probably damaging 1.00
R0749:Krt2 UTSW 15 101817663 missense unknown
R0785:Krt2 UTSW 15 101817921 missense unknown
R0792:Krt2 UTSW 15 101816497 missense probably damaging 1.00
R1232:Krt2 UTSW 15 101811784 missense probably damaging 1.00
R1281:Krt2 UTSW 15 101813292 missense probably damaging 1.00
R1770:Krt2 UTSW 15 101811154 missense unknown
R1783:Krt2 UTSW 15 101813973 missense probably damaging 1.00
R1795:Krt2 UTSW 15 101816426 missense possibly damaging 0.85
R2283:Krt2 UTSW 15 101814387 missense probably damaging 1.00
R3977:Krt2 UTSW 15 101811127 missense unknown
R4575:Krt2 UTSW 15 101814486 missense probably damaging 1.00
R4619:Krt2 UTSW 15 101817591 missense probably damaging 1.00
R4620:Krt2 UTSW 15 101817591 missense probably damaging 1.00
R4766:Krt2 UTSW 15 101813960 missense probably damaging 1.00
R4819:Krt2 UTSW 15 101811544 missense unknown
R4953:Krt2 UTSW 15 101813942 missense probably damaging 1.00
R5108:Krt2 UTSW 15 101813286 missense possibly damaging 0.88
R5973:Krt2 UTSW 15 101816312 missense probably damaging 0.99
R6122:Krt2 UTSW 15 101815914 missense probably damaging 1.00
R6180:Krt2 UTSW 15 101815044 missense probably benign 0.05
R6661:Krt2 UTSW 15 101815963 missense probably damaging 1.00
R6974:Krt2 UTSW 15 101817879 missense unknown
R6993:Krt2 UTSW 15 101815960 missense probably damaging 1.00
R7104:Krt2 UTSW 15 101815087 missense probably benign 0.09
R7573:Krt2 UTSW 15 101814519 missense probably benign 0.05
R7947:Krt2 UTSW 15 101816334 missense probably damaging 1.00
R8469:Krt2 UTSW 15 101816369 missense probably benign 0.22
R8805:Krt2 UTSW 15 101815944 missense possibly damaging 0.93
R9051:Krt2 UTSW 15 101817882 missense unknown
R9118:Krt2 UTSW 15 101814541 missense probably damaging 0.99
R9230:Krt2 UTSW 15 101817513 missense probably benign 0.39
R9257:Krt2 UTSW 15 101816491 missense probably benign 0.05
R9424:Krt2 UTSW 15 101811357 missense unknown
R9569:Krt2 UTSW 15 101816489 missense probably damaging 1.00
RF020:Krt2 UTSW 15 101817968 missense unknown
Z1177:Krt2 UTSW 15 101811550 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGAGCTAGATCCTGCTCC -3'
(R):5'- TAAGACTGGCTTCGGCTCTG -3'

Sequencing Primer
(F):5'- AGCTAGATCCTGCTCCTCCTGAG -3'
(R):5'- AAGCACCTATGGCTCTGGAG -3'
Posted On 2022-08-09