Incidental Mutation 'R9577:Ankar'
ID 722331
Institutional Source Beutler Lab
Gene Symbol Ankar
Ensembl Gene ENSMUSG00000039342
Gene Name ankyrin and armadillo repeat containing
Synonyms 4932422E22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R9577 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 72642980-72700579 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 72681908 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 464 (V464L)
Ref Sequence ENSEMBL: ENSMUSP00000054056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]
AlphaFold A2RT91
Predicted Effect probably benign
Transcript: ENSMUST00000053499
AA Change: V464L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342
AA Change: V464L

DomainStartEndE-ValueType
low complexity region 46 51 N/A INTRINSIC
low complexity region 484 496 N/A INTRINSIC
ANK 532 561 1.25e2 SMART
ANK 582 611 3.49e0 SMART
ANK 615 644 4.44e2 SMART
ANK 651 680 3.8e-1 SMART
ANK 684 714 9.87e0 SMART
ARM 744 784 5.96e-3 SMART
ARM 785 825 4.09e0 SMART
Blast:ARM 827 865 1e-15 BLAST
ARM 867 907 8.34e0 SMART
ARM 909 949 8.34e0 SMART
Blast:ARM 951 991 2e-13 BLAST
ARM 1034 1077 4.82e1 SMART
ARM 1084 1123 1.3e1 SMART
ARM 1257 1297 6.01e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211837
AA Change: V464L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000212573
AA Change: V246L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik G T 18: 24,475,606 A128S probably benign Het
4930539E08Rik A T 17: 28,909,408 I177K probably benign Het
AA792892 A T 5: 94,383,946 R230* probably null Het
Abca14 T C 7: 120,211,545 Y116H probably benign Het
Aipl1 C T 11: 72,037,427 G11D probably damaging Het
Arap2 A T 5: 62,611,717 I1526N probably damaging Het
Atad5 T A 11: 80,114,170 N1144K probably damaging Het
B3gntl1 T C 11: 121,624,214 T243A probably benign Het
Baz2b T C 2: 59,978,687 T73A probably benign Het
Brms1l A G 12: 55,860,091 S148G probably damaging Het
Btnl1 A G 17: 34,384,361 D332G probably benign Het
Card9 T A 2: 26,352,332 T531S probably damaging Het
Ccdc71 C T 9: 108,463,273 A95V possibly damaging Het
Cdh23 A G 10: 60,311,116 V2787A probably damaging Het
Chd7 A G 4: 8,752,964 E487G unknown Het
Col22a1 T C 15: 71,965,746 K505R probably damaging Het
Dennd1b T C 1: 139,090,458 V180A Het
Dmxl2 A G 9: 54,416,380 V1066A unknown Het
Dnah9 C T 11: 65,976,521 V2744M probably benign Het
Fam83e G T 7: 45,727,015 R384L possibly damaging Het
Fbxo42 T A 4: 141,180,432 Y134* probably null Het
Fmn1 C T 2: 113,364,125 P57S unknown Het
Gm6309 T C 5: 146,168,890 R155G possibly damaging Het
Gnpda1 T C 18: 38,330,552 T235A probably benign Het
Gsdmc2 T A 15: 63,825,057 I422F probably damaging Het
Itfg1 A G 8: 85,776,169 V256A probably benign Het
Kcnk2 CAAA CAA 1: 189,256,694 probably null Het
Kif14 T C 1: 136,471,400 V433A probably benign Het
Kif3a T C 11: 53,584,404 F363S probably damaging Het
Lman2l T C 1: 36,428,409 D186G probably damaging Het
Lmntd2 T C 7: 141,211,077 T448A probably benign Het
Magi2 C T 5: 20,609,284 A898V probably damaging Het
Mri1 A G 8: 84,256,300 V164A probably damaging Het
Myb C T 10: 21,154,713 D62N probably benign Het
Nxpe2 G A 9: 48,326,332 R208* probably null Het
Olfr3 C A 2: 36,812,555 C179F probably damaging Het
Olfr945 A G 9: 39,258,441 V77A possibly damaging Het
Pcdha12 C T 18: 37,022,073 A615V probably benign Het
Pou4f3 C G 18: 42,395,498 P169A probably benign Het
Prss36 T C 7: 127,934,501 I556V probably benign Het
Psg23 A T 7: 18,612,142 D209E probably benign Het
Ptpn13 C A 5: 103,528,809 D679E probably damaging Het
Ptprz1 G T 6: 23,002,203 D1431Y probably damaging Het
Sdccag8 T A 1: 176,831,063 L143M probably damaging Het
Shroom1 A G 11: 53,466,785 Q721R probably benign Het
Spdye4b A G 5: 143,196,300 M118V probably damaging Het
Tbc1d1 T A 5: 64,316,356 S741T possibly damaging Het
Tbx18 A G 9: 87,729,459 probably null Het
Tm9sf4 T C 2: 153,195,374 F385S probably benign Het
Trpm4 A T 7: 45,305,008 L1133* probably null Het
Trpm5 A G 7: 143,079,394 probably null Het
Ube4b A G 4: 149,383,774 S182P possibly damaging Het
Ugt2b36 T C 5: 87,080,925 T420A probably benign Het
Vipr1 G A 9: 121,642,927 probably null Het
Zc3h6 T A 2: 129,016,182 I711K Het
Zer1 T C 2: 30,101,038 Y726C probably damaging Het
Other mutations in Ankar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ankar APN 1 72690131 missense probably damaging 1.00
IGL01013:Ankar APN 1 72650989 missense possibly damaging 0.90
IGL01135:Ankar APN 1 72665219 missense probably benign 0.28
IGL01824:Ankar APN 1 72651727 missense probably benign 0.40
IGL01885:Ankar APN 1 72658703 missense probably damaging 1.00
IGL01932:Ankar APN 1 72698987 missense probably benign 0.25
IGL02143:Ankar APN 1 72658649 critical splice donor site probably null
IGL02326:Ankar APN 1 72666355 missense probably damaging 1.00
IGL02445:Ankar APN 1 72666365 missense probably benign 0.05
IGL02606:Ankar APN 1 72690285 missense possibly damaging 0.61
IGL02635:Ankar APN 1 72652431 missense possibly damaging 0.93
IGL02680:Ankar APN 1 72670116 missense probably damaging 1.00
IGL02704:Ankar APN 1 72652343 missense possibly damaging 0.88
IGL03086:Ankar APN 1 72643278 missense possibly damaging 0.84
IGL03269:Ankar APN 1 72665201 missense probably damaging 0.99
IGL03368:Ankar APN 1 72675813 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0488:Ankar UTSW 1 72658732 missense probably damaging 1.00
R0650:Ankar UTSW 1 72656221 splice site probably benign
R1121:Ankar UTSW 1 72651663 splice site probably null
R1163:Ankar UTSW 1 72688705 missense possibly damaging 0.82
R1300:Ankar UTSW 1 72643164 missense probably benign 0.00
R1309:Ankar UTSW 1 72674004 missense possibly damaging 0.59
R1366:Ankar UTSW 1 72698649 missense probably damaging 1.00
R1456:Ankar UTSW 1 72665118 missense probably benign 0.34
R1495:Ankar UTSW 1 72643291 missense probably benign
R1583:Ankar UTSW 1 72679555 splice site probably benign
R1635:Ankar UTSW 1 72650138 missense probably damaging 0.99
R1975:Ankar UTSW 1 72658441 missense possibly damaging 0.95
R2036:Ankar UTSW 1 72666530 nonsense probably null
R2511:Ankar UTSW 1 72658694 missense probably damaging 1.00
R2965:Ankar UTSW 1 72675820 missense probably benign 0.00
R3404:Ankar UTSW 1 72643093 nonsense probably null
R3417:Ankar UTSW 1 72658976 critical splice donor site probably null
R4072:Ankar UTSW 1 72688592 missense probably damaging 1.00
R4231:Ankar UTSW 1 72658542 missense probably benign 0.23
R4447:Ankar UTSW 1 72687789 missense possibly damaging 0.60
R4632:Ankar UTSW 1 72647184 missense probably benign 0.01
R4720:Ankar UTSW 1 72699011 missense possibly damaging 0.55
R4754:Ankar UTSW 1 72698694 missense probably damaging 1.00
R4884:Ankar UTSW 1 72698807 missense probably damaging 0.97
R5068:Ankar UTSW 1 72680210 splice site probably null
R5069:Ankar UTSW 1 72680210 splice site probably null
R5070:Ankar UTSW 1 72680210 splice site probably null
R5189:Ankar UTSW 1 72658414 missense probably benign 0.01
R5247:Ankar UTSW 1 72680184 missense probably benign 0.08
R5322:Ankar UTSW 1 72690386 splice site probably null
R5345:Ankar UTSW 1 72670151 missense possibly damaging 0.94
R5864:Ankar UTSW 1 72659165 missense probably benign 0.00
R5976:Ankar UTSW 1 72643291 missense probably benign
R6003:Ankar UTSW 1 72698887 missense probably damaging 1.00
R6042:Ankar UTSW 1 72674054 nonsense probably null
R6296:Ankar UTSW 1 72643258 missense probably damaging 1.00
R6488:Ankar UTSW 1 72681808 critical splice donor site probably null
R6885:Ankar UTSW 1 72643036 missense unknown
R6985:Ankar UTSW 1 72658482 missense probably damaging 1.00
R7060:Ankar UTSW 1 72656113 missense probably benign 0.18
R7099:Ankar UTSW 1 72643293 missense probably damaging 0.99
R7194:Ankar UTSW 1 72659033 missense probably benign 0.32
R7221:Ankar UTSW 1 72650231 missense probably damaging 1.00
R7222:Ankar UTSW 1 72666355 missense probably damaging 0.99
R7258:Ankar UTSW 1 72651727 missense probably benign 0.40
R7303:Ankar UTSW 1 72659033 missense probably benign 0.32
R7308:Ankar UTSW 1 72651794 nonsense probably null
R7384:Ankar UTSW 1 72658465 missense probably benign 0.00
R7424:Ankar UTSW 1 72680058 missense probably damaging 1.00
R7464:Ankar UTSW 1 72698894 missense possibly damaging 0.94
R7525:Ankar UTSW 1 72688641 missense probably benign 0.18
R7618:Ankar UTSW 1 72675766 missense probably benign 0.22
R7659:Ankar UTSW 1 72690135 missense possibly damaging 0.95
R7974:Ankar UTSW 1 72698979 nonsense probably null
R8008:Ankar UTSW 1 72666484 missense possibly damaging 0.47
R8119:Ankar UTSW 1 72647001 missense probably damaging 0.98
R8244:Ankar UTSW 1 72651024 missense probably benign
R8342:Ankar UTSW 1 72652460 missense probably damaging 1.00
R8494:Ankar UTSW 1 72658794 missense probably benign 0.16
R8851:Ankar UTSW 1 72652376 missense probably damaging 1.00
R8970:Ankar UTSW 1 72652337 critical splice donor site probably null
R9228:Ankar UTSW 1 72674051 missense probably benign 0.27
R9511:Ankar UTSW 1 72680002 missense probably benign 0.23
R9612:Ankar UTSW 1 72665135 missense possibly damaging 0.65
R9647:Ankar UTSW 1 72650148 missense probably damaging 1.00
R9803:Ankar UTSW 1 72659181 missense possibly damaging 0.47
Z1176:Ankar UTSW 1 72689961 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CACCAATGACCAATGACTCTTCTAG -3'
(R):5'- TTATGGAATAAGCAGGGTTTGACAG -3'

Sequencing Primer
(F):5'- GACCAATGACTCTTCTAGTAAACTCC -3'
(R):5'- GCTACTATGTGATCCATTTTG -3'
Posted On 2022-08-09