Incidental Mutation 'R9577:Ankar'
ID 722331
Institutional Source Beutler Lab
Gene Symbol Ankar
Ensembl Gene ENSMUSG00000039342
Gene Name ankyrin and armadillo repeat containing
Synonyms 4932422E22Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R9577 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 72682139-72739738 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 72721067 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 464 (V464L)
Ref Sequence ENSEMBL: ENSMUSP00000054056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]
AlphaFold A2RT91
Predicted Effect probably benign
Transcript: ENSMUST00000053499
AA Change: V464L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342
AA Change: V464L

DomainStartEndE-ValueType
low complexity region 46 51 N/A INTRINSIC
low complexity region 484 496 N/A INTRINSIC
ANK 532 561 1.25e2 SMART
ANK 582 611 3.49e0 SMART
ANK 615 644 4.44e2 SMART
ANK 651 680 3.8e-1 SMART
ANK 684 714 9.87e0 SMART
ARM 744 784 5.96e-3 SMART
ARM 785 825 4.09e0 SMART
Blast:ARM 827 865 1e-15 BLAST
ARM 867 907 8.34e0 SMART
ARM 909 949 8.34e0 SMART
Blast:ARM 951 991 2e-13 BLAST
ARM 1034 1077 4.82e1 SMART
ARM 1084 1123 1.3e1 SMART
ARM 1257 1297 6.01e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211837
AA Change: V464L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000212573
AA Change: V246L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik G T 18: 24,608,663 (GRCm39) A128S probably benign Het
Abca14 T C 7: 119,810,768 (GRCm39) Y116H probably benign Het
Aipl1 C T 11: 71,928,253 (GRCm39) G11D probably damaging Het
Arap2 A T 5: 62,769,060 (GRCm39) I1526N probably damaging Het
Atad5 T A 11: 80,004,996 (GRCm39) N1144K probably damaging Het
B3gntl1 T C 11: 121,515,040 (GRCm39) T243A probably benign Het
Baz2b T C 2: 59,809,031 (GRCm39) T73A probably benign Het
Bnip5 A T 17: 29,128,382 (GRCm39) I177K probably benign Het
Brms1l A G 12: 55,906,876 (GRCm39) S148G probably damaging Het
Btnl1 A G 17: 34,603,335 (GRCm39) D332G probably benign Het
Card9 T A 2: 26,242,344 (GRCm39) T531S probably damaging Het
Ccdc71 C T 9: 108,340,472 (GRCm39) A95V possibly damaging Het
Cdh23 A G 10: 60,146,895 (GRCm39) V2787A probably damaging Het
Chd7 A G 4: 8,752,964 (GRCm39) E487G unknown Het
Col22a1 T C 15: 71,837,595 (GRCm39) K505R probably damaging Het
Dennd1b T C 1: 139,018,196 (GRCm39) V180A Het
Dmxl2 A G 9: 54,323,664 (GRCm39) V1066A unknown Het
Dnah9 C T 11: 65,867,347 (GRCm39) V2744M probably benign Het
Fam83e G T 7: 45,376,439 (GRCm39) R384L possibly damaging Het
Fbxo42 T A 4: 140,907,743 (GRCm39) Y134* probably null Het
Fmn1 C T 2: 113,194,470 (GRCm39) P57S unknown Het
Gm6309 T C 5: 146,105,700 (GRCm39) R155G possibly damaging Het
Gnpda1 T C 18: 38,463,605 (GRCm39) T235A probably benign Het
Gsdmc2 T A 15: 63,696,906 (GRCm39) I422F probably damaging Het
Itfg1 A G 8: 86,502,798 (GRCm39) V256A probably benign Het
Kcnk2 CAAA CAA 1: 188,988,891 (GRCm39) probably null Het
Kif14 T C 1: 136,399,138 (GRCm39) V433A probably benign Het
Kif3a T C 11: 53,475,231 (GRCm39) F363S probably damaging Het
Lman2l T C 1: 36,467,490 (GRCm39) D186G probably damaging Het
Lmntd2 T C 7: 140,790,990 (GRCm39) T448A probably benign Het
Magi2 C T 5: 20,814,282 (GRCm39) A898V probably damaging Het
Mri1 A G 8: 84,982,929 (GRCm39) V164A probably damaging Het
Myb C T 10: 21,030,612 (GRCm39) D62N probably benign Het
Nxpe2 G A 9: 48,237,632 (GRCm39) R208* probably null Het
Or1j1 C A 2: 36,702,567 (GRCm39) C179F probably damaging Het
Or8g28 A G 9: 39,169,737 (GRCm39) V77A possibly damaging Het
Pcdha12 C T 18: 37,155,126 (GRCm39) A615V probably benign Het
Pou4f3 C G 18: 42,528,563 (GRCm39) P169A probably benign Het
Pramel52-ps A T 5: 94,531,805 (GRCm39) R230* probably null Het
Prss36 T C 7: 127,533,673 (GRCm39) I556V probably benign Het
Psg23 A T 7: 18,346,067 (GRCm39) D209E probably benign Het
Ptpn13 C A 5: 103,676,675 (GRCm39) D679E probably damaging Het
Ptprz1 G T 6: 23,002,202 (GRCm39) D1431Y probably damaging Het
Sdccag8 T A 1: 176,658,629 (GRCm39) L143M probably damaging Het
Shroom1 A G 11: 53,357,612 (GRCm39) Q721R probably benign Het
Spdye4b A G 5: 143,182,055 (GRCm39) M118V probably damaging Het
Tbc1d1 T A 5: 64,473,699 (GRCm39) S741T possibly damaging Het
Tbx18 A G 9: 87,611,512 (GRCm39) probably null Het
Tm9sf4 T C 2: 153,037,294 (GRCm39) F385S probably benign Het
Trpm4 A T 7: 44,954,432 (GRCm39) L1133* probably null Het
Trpm5 A G 7: 142,633,131 (GRCm39) probably null Het
Ube4b A G 4: 149,468,231 (GRCm39) S182P possibly damaging Het
Ugt2b36 T C 5: 87,228,784 (GRCm39) T420A probably benign Het
Vipr1 G A 9: 121,471,993 (GRCm39) probably null Het
Zc3h6 T A 2: 128,858,102 (GRCm39) I711K Het
Zer1 T C 2: 29,991,050 (GRCm39) Y726C probably damaging Het
Other mutations in Ankar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ankar APN 1 72,729,290 (GRCm39) missense probably damaging 1.00
IGL01013:Ankar APN 1 72,690,148 (GRCm39) missense possibly damaging 0.90
IGL01135:Ankar APN 1 72,704,378 (GRCm39) missense probably benign 0.28
IGL01824:Ankar APN 1 72,690,886 (GRCm39) missense probably benign 0.40
IGL01885:Ankar APN 1 72,697,862 (GRCm39) missense probably damaging 1.00
IGL01932:Ankar APN 1 72,738,146 (GRCm39) missense probably benign 0.25
IGL02143:Ankar APN 1 72,697,808 (GRCm39) critical splice donor site probably null
IGL02326:Ankar APN 1 72,705,514 (GRCm39) missense probably damaging 1.00
IGL02445:Ankar APN 1 72,705,524 (GRCm39) missense probably benign 0.05
IGL02606:Ankar APN 1 72,729,444 (GRCm39) missense possibly damaging 0.61
IGL02635:Ankar APN 1 72,691,590 (GRCm39) missense possibly damaging 0.93
IGL02680:Ankar APN 1 72,709,275 (GRCm39) missense probably damaging 1.00
IGL02704:Ankar APN 1 72,691,502 (GRCm39) missense possibly damaging 0.88
IGL03086:Ankar APN 1 72,682,437 (GRCm39) missense possibly damaging 0.84
IGL03269:Ankar APN 1 72,704,360 (GRCm39) missense probably damaging 0.99
IGL03368:Ankar APN 1 72,714,972 (GRCm39) missense probably damaging 1.00
R0050:Ankar UTSW 1 72,695,323 (GRCm39) missense probably damaging 1.00
R0050:Ankar UTSW 1 72,695,323 (GRCm39) missense probably damaging 1.00
R0488:Ankar UTSW 1 72,697,891 (GRCm39) missense probably damaging 1.00
R0650:Ankar UTSW 1 72,695,380 (GRCm39) splice site probably benign
R1121:Ankar UTSW 1 72,690,822 (GRCm39) splice site probably null
R1163:Ankar UTSW 1 72,727,864 (GRCm39) missense possibly damaging 0.82
R1300:Ankar UTSW 1 72,682,323 (GRCm39) missense probably benign 0.00
R1309:Ankar UTSW 1 72,713,163 (GRCm39) missense possibly damaging 0.59
R1366:Ankar UTSW 1 72,737,808 (GRCm39) missense probably damaging 1.00
R1456:Ankar UTSW 1 72,704,277 (GRCm39) missense probably benign 0.34
R1495:Ankar UTSW 1 72,682,450 (GRCm39) missense probably benign
R1583:Ankar UTSW 1 72,718,714 (GRCm39) splice site probably benign
R1635:Ankar UTSW 1 72,689,297 (GRCm39) missense probably damaging 0.99
R1975:Ankar UTSW 1 72,697,600 (GRCm39) missense possibly damaging 0.95
R2036:Ankar UTSW 1 72,705,689 (GRCm39) nonsense probably null
R2511:Ankar UTSW 1 72,697,853 (GRCm39) missense probably damaging 1.00
R2965:Ankar UTSW 1 72,714,979 (GRCm39) missense probably benign 0.00
R3404:Ankar UTSW 1 72,682,252 (GRCm39) nonsense probably null
R3417:Ankar UTSW 1 72,698,135 (GRCm39) critical splice donor site probably null
R4072:Ankar UTSW 1 72,727,751 (GRCm39) missense probably damaging 1.00
R4231:Ankar UTSW 1 72,697,701 (GRCm39) missense probably benign 0.23
R4447:Ankar UTSW 1 72,726,948 (GRCm39) missense possibly damaging 0.60
R4632:Ankar UTSW 1 72,686,343 (GRCm39) missense probably benign 0.01
R4720:Ankar UTSW 1 72,738,170 (GRCm39) missense possibly damaging 0.55
R4754:Ankar UTSW 1 72,737,853 (GRCm39) missense probably damaging 1.00
R4884:Ankar UTSW 1 72,737,966 (GRCm39) missense probably damaging 0.97
R5068:Ankar UTSW 1 72,719,369 (GRCm39) splice site probably null
R5069:Ankar UTSW 1 72,719,369 (GRCm39) splice site probably null
R5070:Ankar UTSW 1 72,719,369 (GRCm39) splice site probably null
R5189:Ankar UTSW 1 72,697,573 (GRCm39) missense probably benign 0.01
R5247:Ankar UTSW 1 72,719,343 (GRCm39) missense probably benign 0.08
R5322:Ankar UTSW 1 72,729,545 (GRCm39) splice site probably null
R5345:Ankar UTSW 1 72,709,310 (GRCm39) missense possibly damaging 0.94
R5864:Ankar UTSW 1 72,698,324 (GRCm39) missense probably benign 0.00
R5976:Ankar UTSW 1 72,682,450 (GRCm39) missense probably benign
R6003:Ankar UTSW 1 72,738,046 (GRCm39) missense probably damaging 1.00
R6042:Ankar UTSW 1 72,713,213 (GRCm39) nonsense probably null
R6296:Ankar UTSW 1 72,682,417 (GRCm39) missense probably damaging 1.00
R6488:Ankar UTSW 1 72,720,967 (GRCm39) critical splice donor site probably null
R6885:Ankar UTSW 1 72,682,195 (GRCm39) missense unknown
R6985:Ankar UTSW 1 72,697,641 (GRCm39) missense probably damaging 1.00
R7060:Ankar UTSW 1 72,695,272 (GRCm39) missense probably benign 0.18
R7099:Ankar UTSW 1 72,682,452 (GRCm39) missense probably damaging 0.99
R7194:Ankar UTSW 1 72,698,192 (GRCm39) missense probably benign 0.32
R7221:Ankar UTSW 1 72,689,390 (GRCm39) missense probably damaging 1.00
R7222:Ankar UTSW 1 72,705,514 (GRCm39) missense probably damaging 0.99
R7258:Ankar UTSW 1 72,690,886 (GRCm39) missense probably benign 0.40
R7303:Ankar UTSW 1 72,698,192 (GRCm39) missense probably benign 0.32
R7308:Ankar UTSW 1 72,690,953 (GRCm39) nonsense probably null
R7384:Ankar UTSW 1 72,697,624 (GRCm39) missense probably benign 0.00
R7424:Ankar UTSW 1 72,719,217 (GRCm39) missense probably damaging 1.00
R7464:Ankar UTSW 1 72,738,053 (GRCm39) missense possibly damaging 0.94
R7525:Ankar UTSW 1 72,727,800 (GRCm39) missense probably benign 0.18
R7618:Ankar UTSW 1 72,714,925 (GRCm39) missense probably benign 0.22
R7659:Ankar UTSW 1 72,729,294 (GRCm39) missense possibly damaging 0.95
R7974:Ankar UTSW 1 72,738,138 (GRCm39) nonsense probably null
R8008:Ankar UTSW 1 72,705,643 (GRCm39) missense possibly damaging 0.47
R8119:Ankar UTSW 1 72,686,160 (GRCm39) missense probably damaging 0.98
R8244:Ankar UTSW 1 72,690,183 (GRCm39) missense probably benign
R8342:Ankar UTSW 1 72,691,619 (GRCm39) missense probably damaging 1.00
R8494:Ankar UTSW 1 72,697,953 (GRCm39) missense probably benign 0.16
R8851:Ankar UTSW 1 72,691,535 (GRCm39) missense probably damaging 1.00
R8970:Ankar UTSW 1 72,691,496 (GRCm39) critical splice donor site probably null
R9228:Ankar UTSW 1 72,713,210 (GRCm39) missense probably benign 0.27
R9511:Ankar UTSW 1 72,719,161 (GRCm39) missense probably benign 0.23
R9612:Ankar UTSW 1 72,704,294 (GRCm39) missense possibly damaging 0.65
R9647:Ankar UTSW 1 72,689,307 (GRCm39) missense probably damaging 1.00
R9803:Ankar UTSW 1 72,698,340 (GRCm39) missense possibly damaging 0.47
Z1176:Ankar UTSW 1 72,729,120 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CACCAATGACCAATGACTCTTCTAG -3'
(R):5'- TTATGGAATAAGCAGGGTTTGACAG -3'

Sequencing Primer
(F):5'- GACCAATGACTCTTCTAGTAAACTCC -3'
(R):5'- GCTACTATGTGATCCATTTTG -3'
Posted On 2022-08-09