Incidental Mutation 'R9577:Baz2b'
ID 722339
Institutional Source Beutler Lab
Gene Symbol Baz2b
Ensembl Gene ENSMUSG00000026987
Gene Name bromodomain adjacent to zinc finger domain, 2B
Synonyms D2Ertd794e, 5830435C13Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock # R9577 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 59899363-60209839 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59978687 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 73 (T73A)
Ref Sequence ENSEMBL: ENSMUSP00000088443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550]
AlphaFold A2AUY4
Predicted Effect probably benign
Transcript: ENSMUST00000090925
AA Change: T73A

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: T73A

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 742 1e-12 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112550
AA Change: T73A

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: T73A

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 741 3.4e-13 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Pfam:WHIM3 1638 1676 5.1e-14 PFAM
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik G T 18: 24,475,606 A128S probably benign Het
4930539E08Rik A T 17: 28,909,408 I177K probably benign Het
AA792892 A T 5: 94,383,946 R230* probably null Het
Abca14 T C 7: 120,211,545 Y116H probably benign Het
Aipl1 C T 11: 72,037,427 G11D probably damaging Het
Ankar C A 1: 72,681,908 V464L probably benign Het
Arap2 A T 5: 62,611,717 I1526N probably damaging Het
Atad5 T A 11: 80,114,170 N1144K probably damaging Het
B3gntl1 T C 11: 121,624,214 T243A probably benign Het
Brms1l A G 12: 55,860,091 S148G probably damaging Het
Btnl1 A G 17: 34,384,361 D332G probably benign Het
Card9 T A 2: 26,352,332 T531S probably damaging Het
Ccdc71 C T 9: 108,463,273 A95V possibly damaging Het
Cdh23 A G 10: 60,311,116 V2787A probably damaging Het
Chd7 A G 4: 8,752,964 E487G unknown Het
Col22a1 T C 15: 71,965,746 K505R probably damaging Het
Dennd1b T C 1: 139,090,458 V180A Het
Dmxl2 A G 9: 54,416,380 V1066A unknown Het
Dnah9 C T 11: 65,976,521 V2744M probably benign Het
Fam83e G T 7: 45,727,015 R384L possibly damaging Het
Fbxo42 T A 4: 141,180,432 Y134* probably null Het
Fmn1 C T 2: 113,364,125 P57S unknown Het
Gm6309 T C 5: 146,168,890 R155G possibly damaging Het
Gnpda1 T C 18: 38,330,552 T235A probably benign Het
Gsdmc2 T A 15: 63,825,057 I422F probably damaging Het
Itfg1 A G 8: 85,776,169 V256A probably benign Het
Kcnk2 CAAA CAA 1: 189,256,694 probably null Het
Kif14 T C 1: 136,471,400 V433A probably benign Het
Kif3a T C 11: 53,584,404 F363S probably damaging Het
Lman2l T C 1: 36,428,409 D186G probably damaging Het
Lmntd2 T C 7: 141,211,077 T448A probably benign Het
Magi2 C T 5: 20,609,284 A898V probably damaging Het
Mri1 A G 8: 84,256,300 V164A probably damaging Het
Myb C T 10: 21,154,713 D62N probably benign Het
Nxpe2 G A 9: 48,326,332 R208* probably null Het
Olfr3 C A 2: 36,812,555 C179F probably damaging Het
Olfr945 A G 9: 39,258,441 V77A possibly damaging Het
Pcdha12 C T 18: 37,022,073 A615V probably benign Het
Pou4f3 C G 18: 42,395,498 P169A probably benign Het
Prss36 T C 7: 127,934,501 I556V probably benign Het
Psg23 A T 7: 18,612,142 D209E probably benign Het
Ptpn13 C A 5: 103,528,809 D679E probably damaging Het
Ptprz1 G T 6: 23,002,203 D1431Y probably damaging Het
Sdccag8 T A 1: 176,831,063 L143M probably damaging Het
Shroom1 A G 11: 53,466,785 Q721R probably benign Het
Spdye4b A G 5: 143,196,300 M118V probably damaging Het
Tbc1d1 T A 5: 64,316,356 S741T possibly damaging Het
Tbx18 A G 9: 87,729,459 probably null Het
Tm9sf4 T C 2: 153,195,374 F385S probably benign Het
Trpm4 A T 7: 45,305,008 L1133* probably null Het
Trpm5 A G 7: 143,079,394 probably null Het
Ube4b A G 4: 149,383,774 S182P possibly damaging Het
Ugt2b36 T C 5: 87,080,925 T420A probably benign Het
Vipr1 G A 9: 121,642,927 probably null Het
Zc3h6 T A 2: 129,016,182 I711K Het
Zer1 T C 2: 30,101,038 Y726C probably damaging Het
Other mutations in Baz2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Baz2b APN 2 59912795 missense probably benign 0.02
IGL00476:Baz2b APN 2 59913739 missense probably benign 0.06
IGL00489:Baz2b APN 2 59957675 nonsense probably null
IGL00514:Baz2b APN 2 59962477 missense probably benign 0.11
IGL00678:Baz2b APN 2 60006183 missense unknown
IGL01348:Baz2b APN 2 59933687 missense possibly damaging 0.95
IGL01354:Baz2b APN 2 59968889 missense probably benign 0.18
IGL01924:Baz2b APN 2 59935271 missense probably damaging 1.00
IGL02125:Baz2b APN 2 59968640 missense probably benign 0.12
IGL02314:Baz2b APN 2 59962227 missense probably benign
IGL02370:Baz2b APN 2 59923589 missense possibly damaging 0.77
IGL02473:Baz2b APN 2 59960063 missense probably benign 0.40
IGL02499:Baz2b APN 2 59901496 missense possibly damaging 0.60
IGL02609:Baz2b APN 2 59917369 missense possibly damaging 0.77
IGL02705:Baz2b APN 2 59948260 missense possibly damaging 0.92
IGL02711:Baz2b APN 2 59917505 unclassified probably benign
IGL02716:Baz2b APN 2 59962524 missense possibly damaging 0.53
IGL02724:Baz2b APN 2 59977374 missense possibly damaging 0.70
IGL02750:Baz2b APN 2 59968658 missense possibly damaging 0.73
IGL02869:Baz2b APN 2 59977528 missense probably benign 0.00
IGL02886:Baz2b APN 2 59957743 splice site probably null
IGL02892:Baz2b APN 2 59900736 missense probably damaging 1.00
IGL03132:Baz2b APN 2 59907753 splice site probably benign
IGL03183:Baz2b APN 2 59903296 missense probably benign 0.10
IGL03197:Baz2b APN 2 59901554 missense possibly damaging 0.74
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0122:Baz2b UTSW 2 59913619 splice site probably null
R0136:Baz2b UTSW 2 59901954 missense probably benign 0.22
R0144:Baz2b UTSW 2 59907495 missense probably damaging 0.98
R0403:Baz2b UTSW 2 59969377 missense possibly damaging 0.70
R0498:Baz2b UTSW 2 59901996 unclassified probably benign
R0528:Baz2b UTSW 2 59936739 missense probably damaging 1.00
R1025:Baz2b UTSW 2 59962482 missense probably benign 0.06
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1510:Baz2b UTSW 2 59922209 missense probably damaging 1.00
R1511:Baz2b UTSW 2 59962024 missense probably benign 0.12
R1514:Baz2b UTSW 2 59962326 missense probably benign 0.13
R1519:Baz2b UTSW 2 59948254 missense possibly damaging 0.50
R1523:Baz2b UTSW 2 59968637 missense possibly damaging 0.47
R1630:Baz2b UTSW 2 60006130 missense unknown
R1641:Baz2b UTSW 2 59912890 missense probably damaging 0.99
R1674:Baz2b UTSW 2 59912992 missense possibly damaging 0.53
R1778:Baz2b UTSW 2 60006136 missense unknown
R1826:Baz2b UTSW 2 59968733 missense probably benign 0.12
R1835:Baz2b UTSW 2 59901819 missense probably benign 0.02
R1954:Baz2b UTSW 2 59968743 missense probably benign 0.12
R1981:Baz2b UTSW 2 59923680 missense possibly damaging 0.95
R2029:Baz2b UTSW 2 59912723 unclassified probably benign
R2567:Baz2b UTSW 2 59913911 missense possibly damaging 0.82
R2842:Baz2b UTSW 2 59913004 missense probably benign 0.27
R2848:Baz2b UTSW 2 59924666 missense possibly damaging 0.64
R3809:Baz2b UTSW 2 59968896 missense probably benign 0.12
R3935:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R3936:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R4072:Baz2b UTSW 2 59912573 splice site probably null
R4182:Baz2b UTSW 2 60098457 intron probably benign
R4255:Baz2b UTSW 2 59920572 unclassified probably benign
R4359:Baz2b UTSW 2 59901613 missense possibly damaging 0.87
R4716:Baz2b UTSW 2 59969255 missense probably benign 0.06
R4743:Baz2b UTSW 2 59913911 missense probably benign 0.01
R4772:Baz2b UTSW 2 59958451 missense probably damaging 0.96
R4858:Baz2b UTSW 2 59907743 missense probably benign
R4868:Baz2b UTSW 2 59924882 missense possibly damaging 0.65
R4872:Baz2b UTSW 2 59942759 splice site probably null
R4889:Baz2b UTSW 2 59936726 missense probably damaging 1.00
R4890:Baz2b UTSW 2 59926039 missense probably damaging 0.99
R4914:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4915:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4918:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R5027:Baz2b UTSW 2 60098644 intron probably benign
R5031:Baz2b UTSW 2 59912807 missense probably benign 0.00
R5082:Baz2b UTSW 2 59901491 nonsense probably null
R5133:Baz2b UTSW 2 59962024 missense probably benign 0.12
R5276:Baz2b UTSW 2 59962614 missense probably benign 0.40
R5279:Baz2b UTSW 2 59932152 missense probably damaging 1.00
R5294:Baz2b UTSW 2 59978602 missense probably benign 0.11
R5447:Baz2b UTSW 2 59913988 missense probably damaging 0.99
R5903:Baz2b UTSW 2 59959889 missense probably damaging 0.99
R5910:Baz2b UTSW 2 59977426 missense possibly damaging 0.88
R6140:Baz2b UTSW 2 59912527 missense probably damaging 0.99
R6195:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6199:Baz2b UTSW 2 59978675 missense probably benign 0.00
R6208:Baz2b UTSW 2 59924806 missense probably damaging 1.00
R6233:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6276:Baz2b UTSW 2 59948223 missense probably damaging 1.00
R6324:Baz2b UTSW 2 59906948 missense probably damaging 1.00
R6490:Baz2b UTSW 2 59901729 missense probably damaging 1.00
R6578:Baz2b UTSW 2 59969279 missense possibly damaging 0.47
R6720:Baz2b UTSW 2 59924890 missense probably damaging 1.00
R6760:Baz2b UTSW 2 59962432 missense probably benign 0.40
R6836:Baz2b UTSW 2 59917425 missense probably damaging 1.00
R6859:Baz2b UTSW 2 59901530 missense probably benign 0.01
R6880:Baz2b UTSW 2 59912939 missense probably damaging 0.99
R6916:Baz2b UTSW 2 59968776 missense probably benign
R6978:Baz2b UTSW 2 59907715 missense possibly damaging 0.84
R7037:Baz2b UTSW 2 59933670 critical splice donor site probably null
R7112:Baz2b UTSW 2 59962184 missense possibly damaging 0.53
R7117:Baz2b UTSW 2 59912497 missense
R7198:Baz2b UTSW 2 59962206 missense probably benign 0.00
R7270:Baz2b UTSW 2 59962492 missense possibly damaging 0.96
R7282:Baz2b UTSW 2 59920437 missense probably benign 0.17
R7464:Baz2b UTSW 2 59977448 missense possibly damaging 0.53
R7609:Baz2b UTSW 2 59962473 missense probably benign 0.40
R7703:Baz2b UTSW 2 59917425 missense probably damaging 1.00
R7850:Baz2b UTSW 2 59936716 missense probably damaging 0.98
R7851:Baz2b UTSW 2 59936716 missense probably damaging 0.98
R7988:Baz2b UTSW 2 59962141 missense possibly damaging 0.53
R8079:Baz2b UTSW 2 59900768 missense probably damaging 1.00
R8084:Baz2b UTSW 2 59962236 missense probably benign
R8343:Baz2b UTSW 2 59901514 missense probably damaging 1.00
R8348:Baz2b UTSW 2 59911793 missense
R8438:Baz2b UTSW 2 59917484 nonsense probably null
R8448:Baz2b UTSW 2 59911793 missense
R8511:Baz2b UTSW 2 59901814 missense probably benign
R8893:Baz2b UTSW 2 59924805 missense probably damaging 0.96
R8947:Baz2b UTSW 2 59948239 missense probably benign 0.06
R8998:Baz2b UTSW 2 59969264 missense probably benign 0.02
R9241:Baz2b UTSW 2 59913649 missense probably benign 0.01
R9245:Baz2b UTSW 2 59912987 missense probably benign
R9581:Baz2b UTSW 2 59968956 missense probably benign
R9601:Baz2b UTSW 2 59901503 missense possibly damaging 0.66
R9613:Baz2b UTSW 2 59901480 missense probably benign 0.09
R9639:Baz2b UTSW 2 59901484 missense probably benign 0.01
X0011:Baz2b UTSW 2 59977361 missense possibly damaging 0.53
X0053:Baz2b UTSW 2 59900675 missense probably damaging 1.00
X0064:Baz2b UTSW 2 59969282 missense probably benign
Z1088:Baz2b UTSW 2 59960015 missense probably damaging 1.00
Z1177:Baz2b UTSW 2 59977520 missense probably benign 0.01
Z1188:Baz2b UTSW 2 59977405 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTTCACTCCTGTAGATGTCAG -3'
(R):5'- AGGGAAGGTTCTTCAATCATGGC -3'

Sequencing Primer
(F):5'- TGTAGATGTCAGTACCTTTCTCAG -3'
(R):5'- TCAATCATGGCCTAATAATAAGGGAG -3'
Posted On 2022-08-09