Incidental Mutation 'R9577:Zc3h6'
ID 722341
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Name zinc finger CCCH type containing 6
Synonyms 4631426G04Rik, 4833425H18Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.197) question?
Stock # R9577 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 128809322-128860483 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 128858102 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 711 (I711K)
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110320]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: I711K

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik G T 18: 24,608,663 (GRCm39) A128S probably benign Het
Abca14 T C 7: 119,810,768 (GRCm39) Y116H probably benign Het
Aipl1 C T 11: 71,928,253 (GRCm39) G11D probably damaging Het
Ankar C A 1: 72,721,067 (GRCm39) V464L probably benign Het
Arap2 A T 5: 62,769,060 (GRCm39) I1526N probably damaging Het
Atad5 T A 11: 80,004,996 (GRCm39) N1144K probably damaging Het
B3gntl1 T C 11: 121,515,040 (GRCm39) T243A probably benign Het
Baz2b T C 2: 59,809,031 (GRCm39) T73A probably benign Het
Bnip5 A T 17: 29,128,382 (GRCm39) I177K probably benign Het
Brms1l A G 12: 55,906,876 (GRCm39) S148G probably damaging Het
Btnl1 A G 17: 34,603,335 (GRCm39) D332G probably benign Het
Card9 T A 2: 26,242,344 (GRCm39) T531S probably damaging Het
Ccdc71 C T 9: 108,340,472 (GRCm39) A95V possibly damaging Het
Cdh23 A G 10: 60,146,895 (GRCm39) V2787A probably damaging Het
Chd7 A G 4: 8,752,964 (GRCm39) E487G unknown Het
Col22a1 T C 15: 71,837,595 (GRCm39) K505R probably damaging Het
Dennd1b T C 1: 139,018,196 (GRCm39) V180A Het
Dmxl2 A G 9: 54,323,664 (GRCm39) V1066A unknown Het
Dnah9 C T 11: 65,867,347 (GRCm39) V2744M probably benign Het
Fam83e G T 7: 45,376,439 (GRCm39) R384L possibly damaging Het
Fbxo42 T A 4: 140,907,743 (GRCm39) Y134* probably null Het
Fmn1 C T 2: 113,194,470 (GRCm39) P57S unknown Het
Gm6309 T C 5: 146,105,700 (GRCm39) R155G possibly damaging Het
Gnpda1 T C 18: 38,463,605 (GRCm39) T235A probably benign Het
Gsdmc2 T A 15: 63,696,906 (GRCm39) I422F probably damaging Het
Itfg1 A G 8: 86,502,798 (GRCm39) V256A probably benign Het
Kcnk2 CAAA CAA 1: 188,988,891 (GRCm39) probably null Het
Kif14 T C 1: 136,399,138 (GRCm39) V433A probably benign Het
Kif3a T C 11: 53,475,231 (GRCm39) F363S probably damaging Het
Lman2l T C 1: 36,467,490 (GRCm39) D186G probably damaging Het
Lmntd2 T C 7: 140,790,990 (GRCm39) T448A probably benign Het
Magi2 C T 5: 20,814,282 (GRCm39) A898V probably damaging Het
Mri1 A G 8: 84,982,929 (GRCm39) V164A probably damaging Het
Myb C T 10: 21,030,612 (GRCm39) D62N probably benign Het
Nxpe2 G A 9: 48,237,632 (GRCm39) R208* probably null Het
Or1j1 C A 2: 36,702,567 (GRCm39) C179F probably damaging Het
Or8g28 A G 9: 39,169,737 (GRCm39) V77A possibly damaging Het
Pcdha12 C T 18: 37,155,126 (GRCm39) A615V probably benign Het
Pou4f3 C G 18: 42,528,563 (GRCm39) P169A probably benign Het
Pramel52-ps A T 5: 94,531,805 (GRCm39) R230* probably null Het
Prss36 T C 7: 127,533,673 (GRCm39) I556V probably benign Het
Psg23 A T 7: 18,346,067 (GRCm39) D209E probably benign Het
Ptpn13 C A 5: 103,676,675 (GRCm39) D679E probably damaging Het
Ptprz1 G T 6: 23,002,202 (GRCm39) D1431Y probably damaging Het
Sdccag8 T A 1: 176,658,629 (GRCm39) L143M probably damaging Het
Shroom1 A G 11: 53,357,612 (GRCm39) Q721R probably benign Het
Spdye4b A G 5: 143,182,055 (GRCm39) M118V probably damaging Het
Tbc1d1 T A 5: 64,473,699 (GRCm39) S741T possibly damaging Het
Tbx18 A G 9: 87,611,512 (GRCm39) probably null Het
Tm9sf4 T C 2: 153,037,294 (GRCm39) F385S probably benign Het
Trpm4 A T 7: 44,954,432 (GRCm39) L1133* probably null Het
Trpm5 A G 7: 142,633,131 (GRCm39) probably null Het
Ube4b A G 4: 149,468,231 (GRCm39) S182P possibly damaging Het
Ugt2b36 T C 5: 87,228,784 (GRCm39) T420A probably benign Het
Vipr1 G A 9: 121,471,993 (GRCm39) probably null Het
Zer1 T C 2: 29,991,050 (GRCm39) Y726C probably damaging Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 128,853,795 (GRCm39) missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 128,859,298 (GRCm39) missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128,839,605 (GRCm39) missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128,835,146 (GRCm39) missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 128,858,501 (GRCm39) missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 128,857,531 (GRCm39) missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128,839,715 (GRCm39) missense probably damaging 0.98
BB001:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
BB011:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
R0336:Zc3h6 UTSW 2 128,857,332 (GRCm39) missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 128,856,747 (GRCm39) missense probably benign 0.00
R0538:Zc3h6 UTSW 2 128,859,143 (GRCm39) missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 128,848,736 (GRCm39) missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 128,859,056 (GRCm39) missense probably benign 0.00
R1528:Zc3h6 UTSW 2 128,858,989 (GRCm39) missense probably benign 0.01
R1698:Zc3h6 UTSW 2 128,859,278 (GRCm39) missense probably benign
R1712:Zc3h6 UTSW 2 128,858,654 (GRCm39) missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 128,858,540 (GRCm39) missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128,839,715 (GRCm39) missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 128,848,006 (GRCm39) missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 128,857,538 (GRCm39) missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128,809,750 (GRCm39) missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 128,856,629 (GRCm39) missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128,835,122 (GRCm39) missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 128,857,380 (GRCm39) missense probably benign 0.43
R2899:Zc3h6 UTSW 2 128,844,152 (GRCm39) missense probably benign 0.00
R3711:Zc3h6 UTSW 2 128,859,251 (GRCm39) missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128,839,712 (GRCm39) missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 128,858,060 (GRCm39) missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 128,844,160 (GRCm39) missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 128,852,353 (GRCm39) missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 128,859,229 (GRCm39) missense probably benign 0.00
R5125:Zc3h6 UTSW 2 128,856,399 (GRCm39) missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 128,844,076 (GRCm39) missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 128,844,076 (GRCm39) missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128,835,372 (GRCm39) intron probably benign
R5802:Zc3h6 UTSW 2 128,857,479 (GRCm39) missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128,835,197 (GRCm39) missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128,839,696 (GRCm39) splice site probably null
R5950:Zc3h6 UTSW 2 128,839,710 (GRCm39) nonsense probably null
R6031:Zc3h6 UTSW 2 128,809,732 (GRCm39) missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128,809,732 (GRCm39) missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 128,857,341 (GRCm39) missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128,835,331 (GRCm39) missense unknown
R7340:Zc3h6 UTSW 2 128,835,110 (GRCm39) missense possibly damaging 0.90
R7572:Zc3h6 UTSW 2 128,859,172 (GRCm39) missense probably benign 0.02
R7576:Zc3h6 UTSW 2 128,856,473 (GRCm39) missense probably damaging 1.00
R7797:Zc3h6 UTSW 2 128,857,555 (GRCm39) critical splice donor site probably null
R7924:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
R8048:Zc3h6 UTSW 2 128,858,934 (GRCm39) missense probably benign 0.30
R8877:Zc3h6 UTSW 2 128,856,319 (GRCm39) nonsense probably null
R9076:Zc3h6 UTSW 2 128,859,096 (GRCm39) nonsense probably null
R9687:Zc3h6 UTSW 2 128,859,281 (GRCm39) missense probably damaging 1.00
R9745:Zc3h6 UTSW 2 128,859,155 (GRCm39) missense probably benign 0.08
Z1176:Zc3h6 UTSW 2 128,858,141 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCGAGGGTGAAAGTACATGTAGC -3'
(R):5'- CACAAGTCTAAGGTCCACTGGG -3'

Sequencing Primer
(F):5'- CCAAGTAGGTGGGCCCTCTTAG -3'
(R):5'- TGGGACAGACTCATGCGG -3'
Posted On 2022-08-09