Incidental Mutation 'R9577:Zc3h6'
ID 722341
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Name zinc finger CCCH type containing 6
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock # R9577 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 128967402-129018563 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 129016182 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 711 (I711K)
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110320]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: I711K

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik G T 18: 24,475,606 A128S probably benign Het
4930539E08Rik A T 17: 28,909,408 I177K probably benign Het
AA792892 A T 5: 94,383,946 R230* probably null Het
Abca14 T C 7: 120,211,545 Y116H probably benign Het
Aipl1 C T 11: 72,037,427 G11D probably damaging Het
Ankar C A 1: 72,681,908 V464L probably benign Het
Arap2 A T 5: 62,611,717 I1526N probably damaging Het
Atad5 T A 11: 80,114,170 N1144K probably damaging Het
B3gntl1 T C 11: 121,624,214 T243A probably benign Het
Baz2b T C 2: 59,978,687 T73A probably benign Het
Brms1l A G 12: 55,860,091 S148G probably damaging Het
Btnl1 A G 17: 34,384,361 D332G probably benign Het
Card9 T A 2: 26,352,332 T531S probably damaging Het
Ccdc71 C T 9: 108,463,273 A95V possibly damaging Het
Cdh23 A G 10: 60,311,116 V2787A probably damaging Het
Chd7 A G 4: 8,752,964 E487G unknown Het
Col22a1 T C 15: 71,965,746 K505R probably damaging Het
Dennd1b T C 1: 139,090,458 V180A Het
Dmxl2 A G 9: 54,416,380 V1066A unknown Het
Dnah9 C T 11: 65,976,521 V2744M probably benign Het
Fam83e G T 7: 45,727,015 R384L possibly damaging Het
Fbxo42 T A 4: 141,180,432 Y134* probably null Het
Fmn1 C T 2: 113,364,125 P57S unknown Het
Gm6309 T C 5: 146,168,890 R155G possibly damaging Het
Gnpda1 T C 18: 38,330,552 T235A probably benign Het
Gsdmc2 T A 15: 63,825,057 I422F probably damaging Het
Itfg1 A G 8: 85,776,169 V256A probably benign Het
Kcnk2 CAAA CAA 1: 189,256,694 probably null Het
Kif14 T C 1: 136,471,400 V433A probably benign Het
Kif3a T C 11: 53,584,404 F363S probably damaging Het
Lman2l T C 1: 36,428,409 D186G probably damaging Het
Lmntd2 T C 7: 141,211,077 T448A probably benign Het
Magi2 C T 5: 20,609,284 A898V probably damaging Het
Mri1 A G 8: 84,256,300 V164A probably damaging Het
Myb C T 10: 21,154,713 D62N probably benign Het
Nxpe2 G A 9: 48,326,332 R208* probably null Het
Olfr3 C A 2: 36,812,555 C179F probably damaging Het
Olfr945 A G 9: 39,258,441 V77A possibly damaging Het
Pcdha12 C T 18: 37,022,073 A615V probably benign Het
Pou4f3 C G 18: 42,395,498 P169A probably benign Het
Prss36 T C 7: 127,934,501 I556V probably benign Het
Psg23 A T 7: 18,612,142 D209E probably benign Het
Ptpn13 C A 5: 103,528,809 D679E probably damaging Het
Ptprz1 G T 6: 23,002,203 D1431Y probably damaging Het
Sdccag8 T A 1: 176,831,063 L143M probably damaging Het
Shroom1 A G 11: 53,466,785 Q721R probably benign Het
Spdye4b A G 5: 143,196,300 M118V probably damaging Het
Tbc1d1 T A 5: 64,316,356 S741T possibly damaging Het
Tbx18 A G 9: 87,729,459 probably null Het
Tm9sf4 T C 2: 153,195,374 F385S probably benign Het
Trpm4 A T 7: 45,305,008 L1133* probably null Het
Trpm5 A G 7: 143,079,394 probably null Het
Ube4b A G 4: 149,383,774 S182P possibly damaging Het
Ugt2b36 T C 5: 87,080,925 T420A probably benign Het
Vipr1 G A 9: 121,642,927 probably null Het
Zer1 T C 2: 30,101,038 Y726C probably damaging Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 129011875 missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 129017378 missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128997685 missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128993226 missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 129016581 missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 129015611 missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128997795 missense probably damaging 0.98
BB001:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
BB011:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
R0336:Zc3h6 UTSW 2 129015412 missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 129014827 missense probably benign 0.00
R0538:Zc3h6 UTSW 2 129017223 missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 129006816 missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 129017136 missense probably benign 0.00
R1528:Zc3h6 UTSW 2 129017069 missense probably benign 0.01
R1698:Zc3h6 UTSW 2 129017358 missense probably benign
R1712:Zc3h6 UTSW 2 129016734 missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 129016620 missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128997795 missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 129006086 missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 129015618 missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128967830 missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 129014709 missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128993202 missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 129015460 missense probably benign 0.43
R2899:Zc3h6 UTSW 2 129002232 missense probably benign 0.00
R3711:Zc3h6 UTSW 2 129017331 missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128997792 missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 129016140 missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 129002240 missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 129010433 missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 129017309 missense probably benign 0.00
R5125:Zc3h6 UTSW 2 129014479 missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128993452 intron probably benign
R5802:Zc3h6 UTSW 2 129015559 missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128993277 missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128997776 splice site probably null
R5950:Zc3h6 UTSW 2 128997790 nonsense probably null
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 129015421 missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128993411 missense unknown
R7340:Zc3h6 UTSW 2 128993190 missense possibly damaging 0.90
R7572:Zc3h6 UTSW 2 129017252 missense probably benign 0.02
R7576:Zc3h6 UTSW 2 129014553 missense probably damaging 1.00
R7797:Zc3h6 UTSW 2 129015635 critical splice donor site probably null
R7924:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
R8048:Zc3h6 UTSW 2 129017014 missense probably benign 0.30
R8877:Zc3h6 UTSW 2 129014399 nonsense probably null
R9076:Zc3h6 UTSW 2 129017176 nonsense probably null
R9687:Zc3h6 UTSW 2 129017361 missense probably damaging 1.00
R9745:Zc3h6 UTSW 2 129017235 missense probably benign 0.08
Z1176:Zc3h6 UTSW 2 129016221 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCGAGGGTGAAAGTACATGTAGC -3'
(R):5'- CACAAGTCTAAGGTCCACTGGG -3'

Sequencing Primer
(F):5'- CCAAGTAGGTGGGCCCTCTTAG -3'
(R):5'- TGGGACAGACTCATGCGG -3'
Posted On 2022-08-09