Incidental Mutation 'R9577:Trpm4'
ID 722356
Institutional Source Beutler Lab
Gene Symbol Trpm4
Ensembl Gene ENSMUSG00000038260
Gene Name transient receptor potential cation channel, subfamily M, member 4
Synonyms LTRPC4, TRPM4B, 1110030C19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock # R9577 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 45302632-45333780 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 45305008 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 1133 (L1133*)
Ref Sequence ENSEMBL: ENSMUSP00000040367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042194] [ENSMUST00000209506] [ENSMUST00000210311] [ENSMUST00000211431] [ENSMUST00000211743]
AlphaFold Q7TN37
Predicted Effect probably null
Transcript: ENSMUST00000042194
AA Change: L1133*
SMART Domains Protein: ENSMUSP00000040367
Gene: ENSMUSG00000038260
AA Change: L1133*

DomainStartEndE-ValueType
low complexity region 118 131 N/A INTRINSIC
SCOP:d1awcb_ 378 465 2e-3 SMART
low complexity region 600 612 N/A INTRINSIC
low complexity region 637 645 N/A INTRINSIC
transmembrane domain 688 710 N/A INTRINSIC
Pfam:Ion_trans 781 1051 1.8e-13 PFAM
low complexity region 1089 1096 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209506
Predicted Effect probably null
Transcript: ENSMUST00000210311
AA Change: L48*
Predicted Effect probably benign
Transcript: ENSMUST00000211431
Predicted Effect probably null
Transcript: ENSMUST00000211743
AA Change: L986*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a calcium-activated nonselective ion channel that mediates transport of monovalent cations across membranes, thereby depolarizing the membrane. The activity of the encoded protein increases with increasing intracellular calcium concentration, but this channel does not transport calcium. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display increased Ca2+ influx and IgE-dependent mast cell activation, increased vascular permeability, and enhanced acute anaphylactic responses. Mice homozygous for a different knock-out allele show Ca2+ overload and impaired dendritic cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik G T 18: 24,475,606 A128S probably benign Het
4930539E08Rik A T 17: 28,909,408 I177K probably benign Het
AA792892 A T 5: 94,383,946 R230* probably null Het
Abca14 T C 7: 120,211,545 Y116H probably benign Het
Aipl1 C T 11: 72,037,427 G11D probably damaging Het
Ankar C A 1: 72,681,908 V464L probably benign Het
Arap2 A T 5: 62,611,717 I1526N probably damaging Het
Atad5 T A 11: 80,114,170 N1144K probably damaging Het
B3gntl1 T C 11: 121,624,214 T243A probably benign Het
Baz2b T C 2: 59,978,687 T73A probably benign Het
Brms1l A G 12: 55,860,091 S148G probably damaging Het
Btnl1 A G 17: 34,384,361 D332G probably benign Het
Card9 T A 2: 26,352,332 T531S probably damaging Het
Ccdc71 C T 9: 108,463,273 A95V possibly damaging Het
Cdh23 A G 10: 60,311,116 V2787A probably damaging Het
Chd7 A G 4: 8,752,964 E487G unknown Het
Col22a1 T C 15: 71,965,746 K505R probably damaging Het
Dennd1b T C 1: 139,090,458 V180A Het
Dmxl2 A G 9: 54,416,380 V1066A unknown Het
Dnah9 C T 11: 65,976,521 V2744M probably benign Het
Fam83e G T 7: 45,727,015 R384L possibly damaging Het
Fbxo42 T A 4: 141,180,432 Y134* probably null Het
Fmn1 C T 2: 113,364,125 P57S unknown Het
Gm6309 T C 5: 146,168,890 R155G possibly damaging Het
Gnpda1 T C 18: 38,330,552 T235A probably benign Het
Gsdmc2 T A 15: 63,825,057 I422F probably damaging Het
Itfg1 A G 8: 85,776,169 V256A probably benign Het
Kcnk2 CAAA CAA 1: 189,256,694 probably null Het
Kif14 T C 1: 136,471,400 V433A probably benign Het
Kif3a T C 11: 53,584,404 F363S probably damaging Het
Lman2l T C 1: 36,428,409 D186G probably damaging Het
Lmntd2 T C 7: 141,211,077 T448A probably benign Het
Magi2 C T 5: 20,609,284 A898V probably damaging Het
Mri1 A G 8: 84,256,300 V164A probably damaging Het
Myb C T 10: 21,154,713 D62N probably benign Het
Nxpe2 G A 9: 48,326,332 R208* probably null Het
Olfr3 C A 2: 36,812,555 C179F probably damaging Het
Olfr945 A G 9: 39,258,441 V77A possibly damaging Het
Pcdha12 C T 18: 37,022,073 A615V probably benign Het
Pou4f3 C G 18: 42,395,498 P169A probably benign Het
Prss36 T C 7: 127,934,501 I556V probably benign Het
Psg23 A T 7: 18,612,142 D209E probably benign Het
Ptpn13 C A 5: 103,528,809 D679E probably damaging Het
Ptprz1 G T 6: 23,002,203 D1431Y probably damaging Het
Sdccag8 T A 1: 176,831,063 L143M probably damaging Het
Shroom1 A G 11: 53,466,785 Q721R probably benign Het
Spdye4b A G 5: 143,196,300 M118V probably damaging Het
Tbc1d1 T A 5: 64,316,356 S741T possibly damaging Het
Tbx18 A G 9: 87,729,459 probably null Het
Tm9sf4 T C 2: 153,195,374 F385S probably benign Het
Trpm5 A G 7: 143,079,394 probably null Het
Ube4b A G 4: 149,383,774 S182P possibly damaging Het
Ugt2b36 T C 5: 87,080,925 T420A probably benign Het
Vipr1 G A 9: 121,642,927 probably null Het
Zc3h6 T A 2: 129,016,182 I711K Het
Zer1 T C 2: 30,101,038 Y726C probably damaging Het
Other mutations in Trpm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Trpm4 APN 7 45318349 missense probably benign
IGL01327:Trpm4 APN 7 45315073 missense probably damaging 1.00
IGL02069:Trpm4 APN 7 45319294 missense probably damaging 1.00
IGL02124:Trpm4 APN 7 45310523 missense probably damaging 1.00
IGL02141:Trpm4 APN 7 45318179 splice site probably null
IGL02333:Trpm4 APN 7 45322115 missense possibly damaging 0.85
IGL02338:Trpm4 APN 7 45326998 missense probably damaging 1.00
IGL02741:Trpm4 APN 7 45318488 missense possibly damaging 0.82
R0041:Trpm4 UTSW 7 45304946 critical splice donor site probably null
R0106:Trpm4 UTSW 7 45319240 critical splice donor site probably null
R0270:Trpm4 UTSW 7 45319253 missense possibly damaging 0.45
R0279:Trpm4 UTSW 7 45322048 missense probably damaging 0.99
R0309:Trpm4 UTSW 7 45308706 missense probably damaging 1.00
R0539:Trpm4 UTSW 7 45305472 missense probably damaging 0.99
R0969:Trpm4 UTSW 7 45327907 intron probably benign
R1454:Trpm4 UTSW 7 45317056 missense probably damaging 0.99
R1512:Trpm4 UTSW 7 45315044 missense probably benign 0.07
R1579:Trpm4 UTSW 7 45308597 missense probably damaging 1.00
R1768:Trpm4 UTSW 7 45308612 missense probably damaging 0.97
R2847:Trpm4 UTSW 7 45310598 missense probably damaging 1.00
R3883:Trpm4 UTSW 7 45321998 critical splice donor site probably null
R3884:Trpm4 UTSW 7 45321998 critical splice donor site probably null
R4895:Trpm4 UTSW 7 45318058 missense probably damaging 0.98
R5056:Trpm4 UTSW 7 45308630 missense probably damaging 0.98
R5060:Trpm4 UTSW 7 45321834 missense probably damaging 1.00
R5069:Trpm4 UTSW 7 45310469 missense probably damaging 1.00
R5560:Trpm4 UTSW 7 45310332 missense probably damaging 1.00
R5783:Trpm4 UTSW 7 45310389 missense probably benign
R5874:Trpm4 UTSW 7 45327749 missense probably damaging 1.00
R6176:Trpm4 UTSW 7 45326676 missense probably damaging 1.00
R6302:Trpm4 UTSW 7 45327719 critical splice donor site probably null
R6431:Trpm4 UTSW 7 45326568 missense possibly damaging 0.79
R6762:Trpm4 UTSW 7 45304816 utr 3 prime probably benign
R6827:Trpm4 UTSW 7 45318628 missense possibly damaging 0.89
R6845:Trpm4 UTSW 7 45322329 missense possibly damaging 0.88
R6950:Trpm4 UTSW 7 45319280 missense probably damaging 0.97
R7126:Trpm4 UTSW 7 45310709 splice site probably null
R7159:Trpm4 UTSW 7 45327268 splice site probably null
R7167:Trpm4 UTSW 7 45327719 critical splice donor site probably null
R7386:Trpm4 UTSW 7 45314640 missense possibly damaging 0.47
R7516:Trpm4 UTSW 7 45305020 missense probably damaging 1.00
R7655:Trpm4 UTSW 7 45321809 missense probably benign 0.00
R7656:Trpm4 UTSW 7 45321809 missense probably benign 0.00
R7743:Trpm4 UTSW 7 45308338 missense probably benign 0.14
R7943:Trpm4 UTSW 7 45308681 missense probably damaging 1.00
R7955:Trpm4 UTSW 7 45319259 missense probably damaging 1.00
R8060:Trpm4 UTSW 7 45305451 missense probably damaging 1.00
R8119:Trpm4 UTSW 7 45327128 missense probably damaging 1.00
R8225:Trpm4 UTSW 7 45305334 missense probably benign
R8395:Trpm4 UTSW 7 45309210 missense probably benign 0.00
R8509:Trpm4 UTSW 7 45322361 missense probably damaging 1.00
R8897:Trpm4 UTSW 7 45310631 missense probably benign 0.02
R9674:Trpm4 UTSW 7 45333387 missense possibly damaging 0.87
R9731:Trpm4 UTSW 7 45308630 missense probably damaging 0.98
X0018:Trpm4 UTSW 7 45314634 missense possibly damaging 0.61
X0022:Trpm4 UTSW 7 45310511 missense probably damaging 1.00
Z1177:Trpm4 UTSW 7 45326718 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTTGGACCTGGGAAGACAG -3'
(R):5'- TCAGGATCTGCACCCATCTG -3'

Sequencing Primer
(F):5'- GCCGATCGTACTCTCTGATCTG -3'
(R):5'- CATCTGGGGACGAGGCATG -3'
Posted On 2022-08-09