Mutagenetix > Incidental Mutation

Incidental Mutation 'R9577:Trpm4'

722356

Institutional Source

Beutler Lab

Gene Symbol

Trpm4

Ensembl Gene

ENSMUSG00000038260

Gene Name

transient receptor potential cation channel, subfamily M, member 4

Synonyms

LTRPC4, TRPM4B, 1110030C19Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.202) question?

Stock #

R9577 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

45302632-45333780 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 45305008 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 1133 (L1133*)

Ref Sequence

ENSEMBL: ENSMUSP00000040367 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042194] [ENSMUST00000209506] [ENSMUST00000210311] [ENSMUST00000211431] [ENSMUST00000211743]

AlphaFold

Q7TN37

Predicted Effect

probably null
Transcript: ENSMUST00000042194
AA Change: L1133*

SMART Domains

Protein: ENSMUSP00000040367
Gene: ENSMUSG00000038260
AA Change: L1133*

Domain	Start	End	E-Value	Type
low complexity region	118	131	N/A	INTRINSIC
SCOP:d1awcb_	378	465	2e-3	SMART
low complexity region	600	612	N/A	INTRINSIC
low complexity region	637	645	N/A	INTRINSIC
transmembrane domain	688	710	N/A	INTRINSIC
Pfam:Ion_trans	781	1051	1.8e-13	PFAM
low complexity region	1089	1096	N/A	INTRINSIC
low complexity region	1191	1208	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209506

Predicted Effect

probably null
Transcript: ENSMUST00000210311
AA Change: L48*

Predicted Effect

probably benign
Transcript: ENSMUST00000211431

Predicted Effect

probably null
Transcript: ENSMUST00000211743
AA Change: L986*

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a calcium-activated nonselective ion channel that mediates transport of monovalent cations across membranes, thereby depolarizing the membrane. The activity of the encoded protein increases with increasing intracellular calcium concentration, but this channel does not transport calcium. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display increased Ca2+ influx and IgE-dependent mast cell activation, increased vascular permeability, and enhanced acute anaphylactic responses. Mice homozygous for a different knock-out allele show Ca2+ overload and impaired dendritic cell migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700062C07Rik	G	T	18: 24,475,606	A128S	probably benign	Het
4930539E08Rik	A	T	17: 28,909,408	I177K	probably benign	Het
AA792892	A	T	5: 94,383,946	R230*	probably null	Het
Abca14	T	C	7: 120,211,545	Y116H	probably benign	Het
Aipl1	C	T	11: 72,037,427	G11D	probably damaging	Het
Ankar	C	A	1: 72,681,908	V464L	probably benign	Het
Arap2	A	T	5: 62,611,717	I1526N	probably damaging	Het
Atad5	T	A	11: 80,114,170	N1144K	probably damaging	Het
B3gntl1	T	C	11: 121,624,214	T243A	probably benign	Het
Baz2b	T	C	2: 59,978,687	T73A	probably benign	Het
Brms1l	A	G	12: 55,860,091	S148G	probably damaging	Het
Btnl1	A	G	17: 34,384,361	D332G	probably benign	Het
Card9	T	A	2: 26,352,332	T531S	probably damaging	Het
Ccdc71	C	T	9: 108,463,273	A95V	possibly damaging	Het
Cdh23	A	G	10: 60,311,116	V2787A	probably damaging	Het
Chd7	A	G	4: 8,752,964	E487G	unknown	Het
Col22a1	T	C	15: 71,965,746	K505R	probably damaging	Het
Dennd1b	T	C	1: 139,090,458	V180A		Het
Dmxl2	A	G	9: 54,416,380	V1066A	unknown	Het
Dnah9	C	T	11: 65,976,521	V2744M	probably benign	Het
Fam83e	G	T	7: 45,727,015	R384L	possibly damaging	Het
Fbxo42	T	A	4: 141,180,432	Y134*	probably null	Het
Fmn1	C	T	2: 113,364,125	P57S	unknown	Het
Gm6309	T	C	5: 146,168,890	R155G	possibly damaging	Het
Gnpda1	T	C	18: 38,330,552	T235A	probably benign	Het
Gsdmc2	T	A	15: 63,825,057	I422F	probably damaging	Het
Itfg1	A	G	8: 85,776,169	V256A	probably benign	Het
Kcnk2	CAAA	CAA	1: 189,256,694		probably null	Het
Kif14	T	C	1: 136,471,400	V433A	probably benign	Het
Kif3a	T	C	11: 53,584,404	F363S	probably damaging	Het
Lman2l	T	C	1: 36,428,409	D186G	probably damaging	Het
Lmntd2	T	C	7: 141,211,077	T448A	probably benign	Het
Magi2	C	T	5: 20,609,284	A898V	probably damaging	Het
Mri1	A	G	8: 84,256,300	V164A	probably damaging	Het
Myb	C	T	10: 21,154,713	D62N	probably benign	Het
Nxpe2	G	A	9: 48,326,332	R208*	probably null	Het
Olfr3	C	A	2: 36,812,555	C179F	probably damaging	Het
Olfr945	A	G	9: 39,258,441	V77A	possibly damaging	Het
Pcdha12	C	T	18: 37,022,073	A615V	probably benign	Het
Pou4f3	C	G	18: 42,395,498	P169A	probably benign	Het
Prss36	T	C	7: 127,934,501	I556V	probably benign	Het
Psg23	A	T	7: 18,612,142	D209E	probably benign	Het
Ptpn13	C	A	5: 103,528,809	D679E	probably damaging	Het
Ptprz1	G	T	6: 23,002,203	D1431Y	probably damaging	Het
Sdccag8	T	A	1: 176,831,063	L143M	probably damaging	Het
Shroom1	A	G	11: 53,466,785	Q721R	probably benign	Het
Spdye4b	A	G	5: 143,196,300	M118V	probably damaging	Het
Tbc1d1	T	A	5: 64,316,356	S741T	possibly damaging	Het
Tbx18	A	G	9: 87,729,459		probably null	Het
Tm9sf4	T	C	2: 153,195,374	F385S	probably benign	Het
Trpm5	A	G	7: 143,079,394		probably null	Het
Ube4b	A	G	4: 149,383,774	S182P	possibly damaging	Het
Ugt2b36	T	C	5: 87,080,925	T420A	probably benign	Het
Vipr1	G	A	9: 121,642,927		probably null	Het
Zc3h6	T	A	2: 129,016,182	I711K		Het
Zer1	T	C	2: 30,101,038	Y726C	probably damaging	Het

Other mutations in Trpm4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Trpm4	APN	7	45318349	missense	probably benign
IGL01327:Trpm4	APN	7	45315073	missense	probably damaging	1.00
IGL02069:Trpm4	APN	7	45319294	missense	probably damaging	1.00
IGL02124:Trpm4	APN	7	45310523	missense	probably damaging	1.00
IGL02141:Trpm4	APN	7	45318179	splice site	probably null
IGL02333:Trpm4	APN	7	45322115	missense	possibly damaging	0.85
IGL02338:Trpm4	APN	7	45326998	missense	probably damaging	1.00
IGL02741:Trpm4	APN	7	45318488	missense	possibly damaging	0.82
R0041:Trpm4	UTSW	7	45304946	critical splice donor site	probably null
R0106:Trpm4	UTSW	7	45319240	critical splice donor site	probably null
R0270:Trpm4	UTSW	7	45319253	missense	possibly damaging	0.45
R0279:Trpm4	UTSW	7	45322048	missense	probably damaging	0.99
R0309:Trpm4	UTSW	7	45308706	missense	probably damaging	1.00
R0539:Trpm4	UTSW	7	45305472	missense	probably damaging	0.99
R0969:Trpm4	UTSW	7	45327907	intron	probably benign
R1454:Trpm4	UTSW	7	45317056	missense	probably damaging	0.99
R1512:Trpm4	UTSW	7	45315044	missense	probably benign	0.07
R1579:Trpm4	UTSW	7	45308597	missense	probably damaging	1.00
R1768:Trpm4	UTSW	7	45308612	missense	probably damaging	0.97
R2847:Trpm4	UTSW	7	45310598	missense	probably damaging	1.00
R3883:Trpm4	UTSW	7	45321998	critical splice donor site	probably null
R3884:Trpm4	UTSW	7	45321998	critical splice donor site	probably null
R4895:Trpm4	UTSW	7	45318058	missense	probably damaging	0.98
R5056:Trpm4	UTSW	7	45308630	missense	probably damaging	0.98
R5060:Trpm4	UTSW	7	45321834	missense	probably damaging	1.00
R5069:Trpm4	UTSW	7	45310469	missense	probably damaging	1.00
R5560:Trpm4	UTSW	7	45310332	missense	probably damaging	1.00
R5783:Trpm4	UTSW	7	45310389	missense	probably benign
R5874:Trpm4	UTSW	7	45327749	missense	probably damaging	1.00
R6176:Trpm4	UTSW	7	45326676	missense	probably damaging	1.00
R6302:Trpm4	UTSW	7	45327719	critical splice donor site	probably null
R6431:Trpm4	UTSW	7	45326568	missense	possibly damaging	0.79
R6762:Trpm4	UTSW	7	45304816	utr 3 prime	probably benign
R6827:Trpm4	UTSW	7	45318628	missense	possibly damaging	0.89
R6845:Trpm4	UTSW	7	45322329	missense	possibly damaging	0.88
R6950:Trpm4	UTSW	7	45319280	missense	probably damaging	0.97
R7126:Trpm4	UTSW	7	45310709	splice site	probably null
R7159:Trpm4	UTSW	7	45327268	splice site	probably null
R7167:Trpm4	UTSW	7	45327719	critical splice donor site	probably null
R7386:Trpm4	UTSW	7	45314640	missense	possibly damaging	0.47
R7516:Trpm4	UTSW	7	45305020	missense	probably damaging	1.00
R7655:Trpm4	UTSW	7	45321809	missense	probably benign	0.00
R7656:Trpm4	UTSW	7	45321809	missense	probably benign	0.00
R7743:Trpm4	UTSW	7	45308338	missense	probably benign	0.14
R7943:Trpm4	UTSW	7	45308681	missense	probably damaging	1.00
R7955:Trpm4	UTSW	7	45319259	missense	probably damaging	1.00
R8060:Trpm4	UTSW	7	45305451	missense	probably damaging	1.00
R8119:Trpm4	UTSW	7	45327128	missense	probably damaging	1.00
R8225:Trpm4	UTSW	7	45305334	missense	probably benign
R8395:Trpm4	UTSW	7	45309210	missense	probably benign	0.00
R8509:Trpm4	UTSW	7	45322361	missense	probably damaging	1.00
R8897:Trpm4	UTSW	7	45310631	missense	probably benign	0.02
R9674:Trpm4	UTSW	7	45333387	missense	possibly damaging	0.87
R9731:Trpm4	UTSW	7	45308630	missense	probably damaging	0.98
X0018:Trpm4	UTSW	7	45314634	missense	possibly damaging	0.61
X0022:Trpm4	UTSW	7	45310511	missense	probably damaging	1.00
Z1177:Trpm4	UTSW	7	45326718	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGTTGGACCTGGGAAGACAG -3'
(R):5'- TCAGGATCTGCACCCATCTG -3'

Sequencing Primer
(F):5'- GCCGATCGTACTCTCTGATCTG -3'
(R):5'- CATCTGGGGACGAGGCATG -3'

Posted On

2022-08-09