Incidental Mutation 'R9577:Prss36'
ID 722359
Institutional Source Beutler Lab
Gene Symbol Prss36
Ensembl Gene ENSMUSG00000070371
Gene Name serine protease 36
Synonyms C330007D15Rik, polyserase-2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9577 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 127531810-127545897 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 127533673 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 556 (I556V)
Ref Sequence ENSEMBL: ENSMUSP00000091565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032988] [ENSMUST00000094026] [ENSMUST00000118755] [ENSMUST00000141385] [ENSMUST00000156152] [ENSMUST00000206124] [ENSMUST00000206568]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000032988
SMART Domains Protein: ENSMUSP00000032988
Gene: ENSMUSG00000030800

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Tryp_SPc 44 281 3.55e-98 SMART
low complexity region 320 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094026
AA Change: I556V

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091565
Gene: ENSMUSG00000070371
AA Change: I556V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 47 287 3.75e-88 SMART
Pfam:Trypsin 325 556 1.2e-16 PFAM
Pfam:Trypsin 599 798 6.6e-20 PFAM
Pfam:DUF1986 607 707 1.4e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118755
AA Change: I545V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112659
Gene: ENSMUSG00000070371
AA Change: I545V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 47 287 3.75e-88 SMART
Pfam:Trypsin 325 545 9.7e-18 PFAM
Pfam:Trypsin 588 787 6.5e-20 PFAM
Pfam:DUF1986 590 696 8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141385
SMART Domains Protein: ENSMUSP00000120544
Gene: ENSMUSG00000070371

DomainStartEndE-ValueType
Blast:Tryp_SPc 38 121 3e-44 BLAST
SCOP:d1eaxa_ 45 126 7e-10 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000121706
Gene: ENSMUSG00000070371
AA Change: I44V

DomainStartEndE-ValueType
Blast:Tryp_SPc 2 44 1e-21 BLAST
Tryp_SPc 89 238 8.18e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206124
Predicted Effect probably benign
Transcript: ENSMUST00000206568
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik G T 18: 24,608,663 (GRCm39) A128S probably benign Het
Abca14 T C 7: 119,810,768 (GRCm39) Y116H probably benign Het
Aipl1 C T 11: 71,928,253 (GRCm39) G11D probably damaging Het
Ankar C A 1: 72,721,067 (GRCm39) V464L probably benign Het
Arap2 A T 5: 62,769,060 (GRCm39) I1526N probably damaging Het
Atad5 T A 11: 80,004,996 (GRCm39) N1144K probably damaging Het
B3gntl1 T C 11: 121,515,040 (GRCm39) T243A probably benign Het
Baz2b T C 2: 59,809,031 (GRCm39) T73A probably benign Het
Bnip5 A T 17: 29,128,382 (GRCm39) I177K probably benign Het
Brms1l A G 12: 55,906,876 (GRCm39) S148G probably damaging Het
Btnl1 A G 17: 34,603,335 (GRCm39) D332G probably benign Het
Card9 T A 2: 26,242,344 (GRCm39) T531S probably damaging Het
Ccdc71 C T 9: 108,340,472 (GRCm39) A95V possibly damaging Het
Cdh23 A G 10: 60,146,895 (GRCm39) V2787A probably damaging Het
Chd7 A G 4: 8,752,964 (GRCm39) E487G unknown Het
Col22a1 T C 15: 71,837,595 (GRCm39) K505R probably damaging Het
Dennd1b T C 1: 139,018,196 (GRCm39) V180A Het
Dmxl2 A G 9: 54,323,664 (GRCm39) V1066A unknown Het
Dnah9 C T 11: 65,867,347 (GRCm39) V2744M probably benign Het
Fam83e G T 7: 45,376,439 (GRCm39) R384L possibly damaging Het
Fbxo42 T A 4: 140,907,743 (GRCm39) Y134* probably null Het
Fmn1 C T 2: 113,194,470 (GRCm39) P57S unknown Het
Gm6309 T C 5: 146,105,700 (GRCm39) R155G possibly damaging Het
Gnpda1 T C 18: 38,463,605 (GRCm39) T235A probably benign Het
Gsdmc2 T A 15: 63,696,906 (GRCm39) I422F probably damaging Het
Itfg1 A G 8: 86,502,798 (GRCm39) V256A probably benign Het
Kcnk2 CAAA CAA 1: 188,988,891 (GRCm39) probably null Het
Kif14 T C 1: 136,399,138 (GRCm39) V433A probably benign Het
Kif3a T C 11: 53,475,231 (GRCm39) F363S probably damaging Het
Lman2l T C 1: 36,467,490 (GRCm39) D186G probably damaging Het
Lmntd2 T C 7: 140,790,990 (GRCm39) T448A probably benign Het
Magi2 C T 5: 20,814,282 (GRCm39) A898V probably damaging Het
Mri1 A G 8: 84,982,929 (GRCm39) V164A probably damaging Het
Myb C T 10: 21,030,612 (GRCm39) D62N probably benign Het
Nxpe2 G A 9: 48,237,632 (GRCm39) R208* probably null Het
Or1j1 C A 2: 36,702,567 (GRCm39) C179F probably damaging Het
Or8g28 A G 9: 39,169,737 (GRCm39) V77A possibly damaging Het
Pcdha12 C T 18: 37,155,126 (GRCm39) A615V probably benign Het
Pou4f3 C G 18: 42,528,563 (GRCm39) P169A probably benign Het
Pramel52-ps A T 5: 94,531,805 (GRCm39) R230* probably null Het
Psg23 A T 7: 18,346,067 (GRCm39) D209E probably benign Het
Ptpn13 C A 5: 103,676,675 (GRCm39) D679E probably damaging Het
Ptprz1 G T 6: 23,002,202 (GRCm39) D1431Y probably damaging Het
Sdccag8 T A 1: 176,658,629 (GRCm39) L143M probably damaging Het
Shroom1 A G 11: 53,357,612 (GRCm39) Q721R probably benign Het
Spdye4b A G 5: 143,182,055 (GRCm39) M118V probably damaging Het
Tbc1d1 T A 5: 64,473,699 (GRCm39) S741T possibly damaging Het
Tbx18 A G 9: 87,611,512 (GRCm39) probably null Het
Tm9sf4 T C 2: 153,037,294 (GRCm39) F385S probably benign Het
Trpm4 A T 7: 44,954,432 (GRCm39) L1133* probably null Het
Trpm5 A G 7: 142,633,131 (GRCm39) probably null Het
Ube4b A G 4: 149,468,231 (GRCm39) S182P possibly damaging Het
Ugt2b36 T C 5: 87,228,784 (GRCm39) T420A probably benign Het
Vipr1 G A 9: 121,471,993 (GRCm39) probably null Het
Zc3h6 T A 2: 128,858,102 (GRCm39) I711K Het
Zer1 T C 2: 29,991,050 (GRCm39) Y726C probably damaging Het
Other mutations in Prss36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Prss36 APN 7 127,544,099 (GRCm39) splice site probably benign
IGL01473:Prss36 APN 7 127,543,873 (GRCm39) missense probably damaging 0.98
IGL03139:Prss36 APN 7 127,532,783 (GRCm39) missense probably damaging 1.00
R0111:Prss36 UTSW 7 127,533,717 (GRCm39) missense probably damaging 1.00
R0295:Prss36 UTSW 7 127,535,027 (GRCm39) missense possibly damaging 0.80
R1771:Prss36 UTSW 7 127,532,625 (GRCm39) missense probably damaging 1.00
R1827:Prss36 UTSW 7 127,532,664 (GRCm39) missense probably damaging 1.00
R3935:Prss36 UTSW 7 127,533,780 (GRCm39) missense probably damaging 1.00
R4257:Prss36 UTSW 7 127,532,010 (GRCm39) unclassified probably benign
R4694:Prss36 UTSW 7 127,534,787 (GRCm39) missense probably damaging 1.00
R5384:Prss36 UTSW 7 127,535,871 (GRCm39) missense probably damaging 1.00
R5464:Prss36 UTSW 7 127,533,405 (GRCm39) missense probably damaging 1.00
R5524:Prss36 UTSW 7 127,533,637 (GRCm39) nonsense probably null
R5749:Prss36 UTSW 7 127,532,814 (GRCm39) missense probably damaging 1.00
R5905:Prss36 UTSW 7 127,532,744 (GRCm39) missense probably benign 0.26
R5992:Prss36 UTSW 7 127,544,002 (GRCm39) missense probably damaging 1.00
R6033:Prss36 UTSW 7 127,533,739 (GRCm39) missense probably benign 0.07
R6033:Prss36 UTSW 7 127,533,739 (GRCm39) missense probably benign 0.07
R6971:Prss36 UTSW 7 127,544,410 (GRCm39) missense probably benign 0.15
R7050:Prss36 UTSW 7 127,543,937 (GRCm39) missense possibly damaging 0.71
R7232:Prss36 UTSW 7 127,534,763 (GRCm39) missense probably benign 0.07
R7271:Prss36 UTSW 7 127,543,877 (GRCm39) missense probably benign 0.10
R8679:Prss36 UTSW 7 127,532,635 (GRCm39) missense possibly damaging 0.89
R9232:Prss36 UTSW 7 127,543,988 (GRCm39) missense probably benign
R9327:Prss36 UTSW 7 127,532,570 (GRCm39) nonsense probably null
R9356:Prss36 UTSW 7 127,545,697 (GRCm39) start gained probably benign
R9433:Prss36 UTSW 7 127,533,339 (GRCm39) missense probably benign 0.01
R9471:Prss36 UTSW 7 127,545,605 (GRCm39) missense probably benign 0.01
Z1088:Prss36 UTSW 7 127,533,709 (GRCm39) nonsense probably null
Z1177:Prss36 UTSW 7 127,533,005 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTCGCCAGGACCTAAGAATTAC -3'
(R):5'- ACTGGAACTTGGCTTGAAGGG -3'

Sequencing Primer
(F):5'- GGACCTAAGAATTACCAGGAACTC -3'
(R):5'- CTTGAAGGGTTCTTGCAGGAAAG -3'
Posted On 2022-08-09