Incidental Mutation 'R9578:Cux1'
ID 722405
Institutional Source Beutler Lab
Gene Symbol Cux1
Ensembl Gene ENSMUSG00000029705
Gene Name cut-like homeobox 1
Synonyms Cux-1, Cutl1, CDP, Cux
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.887) question?
Stock # R9578 (G1)
Quality Score 161.009
Status Not validated
Chromosome 5
Chromosomal Location 136248135-136567490 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 136254065 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175918] [ENSMUST00000175998] [ENSMUST00000176216] [ENSMUST00000176745] [ENSMUST00000177297]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000175918
SMART Domains Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 73 328 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175998
SMART Domains Protein: ENSMUSP00000135816
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
coiled coil region 76 148 N/A INTRINSIC
Pfam:CASP_C 204 430 8.6e-72 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000176216
SMART Domains Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 9.35e-5 PROSPERO
Pfam:CASP_C 421 647 1.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176745
SMART Domains Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
internal_repeat_1 367 388 8.95e-5 PROSPERO
Pfam:CASP_C 419 645 1.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177297
SMART Domains Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 8.99e-6 PROSPERO
Pfam:CASP_C 422 527 1.8e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik G A 8: 105,709,873 G234S probably damaging Het
Aipl1 C T 11: 72,037,427 G11D probably damaging Het
Aldh8a1 A G 10: 21,377,382 I14M probably damaging Het
Arhgap11a A G 2: 113,839,780 S333P possibly damaging Het
Atp1b3 A T 9: 96,338,701 D180E probably benign Het
B3gnt8 T C 7: 25,628,664 L173P probably damaging Het
Cabin1 A G 10: 75,754,351 F37S probably damaging Het
Carmil3 G T 14: 55,503,836 probably null Het
Cfi G T 3: 129,865,375 M327I probably benign Het
Cltc G A 11: 86,702,411 S1542F probably benign Het
Col7a1 G A 9: 108,960,282 G854D unknown Het
Dcdc2c G T 12: 28,552,235 N23K probably damaging Het
Dclre1a A G 19: 56,540,302 I807T probably damaging Het
Dnah14 T C 1: 181,674,442 F1770L probably benign Het
Dnajc13 A G 9: 104,238,527 F28L probably benign Het
Dtna A G 18: 23,595,555 D269G probably damaging Het
Dusp4 G T 8: 34,807,668 probably benign Het
Ece1 T C 4: 137,913,822 S19P probably benign Het
Gas1 T C 13: 60,176,091 D243G possibly damaging Het
Ggnbp2 A G 11: 84,854,163 C178R probably benign Het
Gm12185 T A 11: 48,915,581 N261I probably benign Het
Grm4 A T 17: 27,450,209 F362I possibly damaging Het
Icos T A 1: 60,993,712 N23K probably benign Het
Kcnk2 CAAA CAA 1: 189,256,694 probably null Het
Krt5 T C 15: 101,711,718 K188R probably damaging Het
Mindy3 C T 2: 12,356,904 probably null Het
Ncdn C T 4: 126,752,002 R38H probably damaging Het
Nol9 A G 4: 152,041,249 K219R probably benign Het
Olfr955 A T 9: 39,469,905 S274T probably damaging Het
Opalin A T 19: 41,072,229 S2R probably damaging Het
Pask G A 1: 93,335,668 S122L probably benign Het
Pcdha11 T C 18: 37,007,123 S602P probably damaging Het
Pclo A G 5: 14,766,739 K1271R Het
Piezo1 T C 8: 122,497,475 H763R Het
Pigr A G 1: 130,849,613 K719E probably benign Het
Piwil4 A T 9: 14,727,494 V245E probably damaging Het
Plcb4 A G 2: 135,987,524 M925V probably benign Het
Pomt1 G A 2: 32,243,531 probably null Het
Pou2f2 C A 7: 25,097,144 A302S probably benign Het
Rapgef4 A T 2: 72,195,708 H359L probably damaging Het
Rfesd C T 13: 76,008,180 V36I possibly damaging Het
Rims1 G A 1: 22,484,742 T421M probably damaging Het
Serpinf2 T A 11: 75,436,789 H150L probably benign Het
Syt10 A T 15: 89,790,919 M408K possibly damaging Het
Tcea1 T A 1: 4,890,798 probably null Het
Tia1 T C 6: 86,430,365 *387R probably null Het
Top3a A C 11: 60,756,691 V186G probably damaging Het
Upk3b T A 5: 136,038,882 S27R unknown Het
Usp18 A G 6: 121,262,767 S274G probably benign Het
Vmn1r230 C A 17: 20,846,901 C117* probably null Het
Vmn1r72 T C 7: 11,670,420 I34V probably benign Het
Vmn2r74 T C 7: 85,956,893 D415G probably benign Het
Zfp54 A G 17: 21,434,924 Y560C probably damaging Het
Other mutations in Cux1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cux1 APN 5 136326796 missense probably damaging 1.00
IGL00966:Cux1 APN 5 136311491 intron probably benign
IGL01129:Cux1 APN 5 136304718 intron probably benign
IGL01885:Cux1 APN 5 136308447 missense possibly damaging 0.90
IGL01947:Cux1 APN 5 136275125 missense probably benign 0.04
IGL02259:Cux1 APN 5 136326833 missense probably damaging 1.00
IGL02666:Cux1 APN 5 136275315 nonsense probably null
IGL02826:Cux1 APN 5 136308003 missense probably damaging 1.00
IGL03014:Cux1 UTSW 5 136565525 intron probably benign
R0047:Cux1 UTSW 5 136363253 splice site probably benign
R0047:Cux1 UTSW 5 136363253 splice site probably benign
R0057:Cux1 UTSW 5 136256282 missense probably damaging 1.00
R0149:Cux1 UTSW 5 136279497 missense probably damaging 1.00
R0295:Cux1 UTSW 5 136313212 missense probably benign 0.04
R0361:Cux1 UTSW 5 136279497 missense probably damaging 1.00
R0533:Cux1 UTSW 5 136307859 missense probably damaging 1.00
R0630:Cux1 UTSW 5 136286835 missense probably damaging 1.00
R0801:Cux1 UTSW 5 136326929 missense probably damaging 0.97
R0884:Cux1 UTSW 5 136307835 missense probably damaging 1.00
R0976:Cux1 UTSW 5 136313290 missense probably damaging 1.00
R1073:Cux1 UTSW 5 136252541 critical splice donor site probably null
R1222:Cux1 UTSW 5 136275149 missense probably benign 0.18
R1518:Cux1 UTSW 5 136308279 missense probably benign 0.29
R1686:Cux1 UTSW 5 136275381 nonsense probably null
R1687:Cux1 UTSW 5 136312669 missense probably damaging 1.00
R1758:Cux1 UTSW 5 136392322 missense probably damaging 1.00
R1797:Cux1 UTSW 5 136275315 missense probably benign 0.22
R1919:Cux1 UTSW 5 136363319 nonsense probably null
R2051:Cux1 UTSW 5 136332658 missense probably damaging 1.00
R2339:Cux1 UTSW 5 136287008 missense probably damaging 1.00
R3438:Cux1 UTSW 5 136311560 missense probably damaging 0.97
R3713:Cux1 UTSW 5 136565543 intron probably benign
R3800:Cux1 UTSW 5 136316033 missense probably damaging 1.00
R3964:Cux1 UTSW 5 136282942 missense probably damaging 1.00
R4135:Cux1 UTSW 5 136307896 missense probably damaging 1.00
R4198:Cux1 UTSW 5 136286848 missense probably damaging 1.00
R4467:Cux1 UTSW 5 136312722 missense probably damaging 1.00
R4498:Cux1 UTSW 5 136312993 missense probably damaging 1.00
R4622:Cux1 UTSW 5 136308300 missense probably damaging 0.99
R4623:Cux1 UTSW 5 136308300 missense probably damaging 0.99
R4651:Cux1 UTSW 5 136567229 missense probably damaging 1.00
R4652:Cux1 UTSW 5 136567229 missense probably damaging 1.00
R4658:Cux1 UTSW 5 136250594 missense possibly damaging 0.80
R4665:Cux1 UTSW 5 136286799 missense probably damaging 1.00
R4704:Cux1 UTSW 5 136249201 missense probably benign 0.01
R4867:Cux1 UTSW 5 136274961 intron probably benign
R4965:Cux1 UTSW 5 136311556 missense possibly damaging 0.77
R5090:Cux1 UTSW 5 136313200 missense possibly damaging 0.95
R5155:Cux1 UTSW 5 136565441 intron probably benign
R5226:Cux1 UTSW 5 136370173 missense probably benign 0.01
R5252:Cux1 UTSW 5 136308297 missense probably damaging 0.98
R5266:Cux1 UTSW 5 136312694 missense probably damaging 1.00
R5399:Cux1 UTSW 5 136252604 missense possibly damaging 0.58
R5509:Cux1 UTSW 5 136275317 missense probably benign 0.13
R5609:Cux1 UTSW 5 136392320 missense probably damaging 1.00
R5681:Cux1 UTSW 5 136308184 missense probably damaging 1.00
R5993:Cux1 UTSW 5 136363271 missense probably benign 0.00
R6049:Cux1 UTSW 5 136332710 missense probably damaging 1.00
R6290:Cux1 UTSW 5 136311558 missense probably damaging 0.99
R6310:Cux1 UTSW 5 136275164 missense probably benign 0.10
R6351:Cux1 UTSW 5 136309792 missense probably damaging 1.00
R6531:Cux1 UTSW 5 136275119 missense probably benign 0.03
R6590:Cux1 UTSW 5 136340117 missense probably damaging 0.99
R6663:Cux1 UTSW 5 136485847 missense probably damaging 1.00
R6690:Cux1 UTSW 5 136340117 missense probably damaging 0.99
R6777:Cux1 UTSW 5 136565568 intron probably benign
R6786:Cux1 UTSW 5 136567231 missense probably damaging 1.00
R6817:Cux1 UTSW 5 136373173 splice site probably null
R6989:Cux1 UTSW 5 136279648 nonsense probably null
R7011:Cux1 UTSW 5 136360033 missense probably damaging 1.00
R7167:Cux1 UTSW 5 136310041 splice site probably null
R7699:Cux1 UTSW 5 136485739 critical splice donor site probably null
R7861:Cux1 UTSW 5 136252604 missense possibly damaging 0.58
R7876:Cux1 UTSW 5 136363307 missense probably benign 0.00
R7916:Cux1 UTSW 5 136282961 missense probably damaging 1.00
R8023:Cux1 UTSW 5 136373397 missense probably damaging 0.99
R8154:Cux1 UTSW 5 136252580 missense probably damaging 1.00
R8267:Cux1 UTSW 5 136282999 missense probably damaging 1.00
R8289:Cux1 UTSW 5 136308504 missense probably damaging 0.99
R8305:Cux1 UTSW 5 136360009 missense probably benign 0.02
R8319:Cux1 UTSW 5 136565397 missense probably benign 0.02
R8405:Cux1 UTSW 5 136275387 missense possibly damaging 0.83
R8483:Cux1 UTSW 5 136275090 missense possibly damaging 0.83
R8506:Cux1 UTSW 5 136308504 missense probably damaging 0.99
R8671:Cux1 UTSW 5 136250600 missense probably damaging 1.00
R8680:Cux1 UTSW 5 136307856 missense possibly damaging 0.46
R8737:Cux1 UTSW 5 136282942 missense probably damaging 1.00
R8738:Cux1 UTSW 5 136373366 missense probably damaging 1.00
R8793:Cux1 UTSW 5 136565685 missense unknown
R8897:Cux1 UTSW 5 136286769 missense probably damaging 1.00
R8926:Cux1 UTSW 5 136309550 intron probably benign
R8954:Cux1 UTSW 5 136373349 nonsense probably null
R9092:Cux1 UTSW 5 136485817 missense probably damaging 1.00
R9205:Cux1 UTSW 5 136370135 missense probably damaging 1.00
R9550:Cux1 UTSW 5 136311533 missense probably damaging 0.99
R9682:Cux1 UTSW 5 136308262 missense probably benign
R9701:Cux1 UTSW 5 136314315 missense probably damaging 0.97
R9712:Cux1 UTSW 5 136309819 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TCAGGTACTATGCACGGAGC -3'
(R):5'- TGAGGAGAGTCAGCACTTCAGG -3'

Sequencing Primer
(F):5'- ACCACCCAGTGGATTACT -3'
(R):5'- CTCAGCGGGTAAAGTGTTCAC -3'
Posted On 2022-08-09