Incidental Mutation 'R9578:Dtna'
ID 722437
Institutional Source Beutler Lab
Gene Symbol Dtna
Ensembl Gene ENSMUSG00000024302
Gene Name dystrobrevin alpha
Synonyms a-DB-1, A0, alpha-dystrobrevin, 2210407P21Rik, 87K protein, Dtn, adbn
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.207) question?
Stock # R9578 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 23548192-23792772 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23728612 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 269 (D269G)
Ref Sequence ENSEMBL: ENSMUSP00000152288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047954] [ENSMUST00000115832] [ENSMUST00000220904] [ENSMUST00000221880]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000047954
AA Change: D269G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000037475
Gene: ENSMUSG00000024302
AA Change: D269G

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 4.9e-43 PFAM
Pfam:EF-hand_3 144 232 7.8e-38 PFAM
ZnF_ZZ 237 282 1.29e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115832
AA Change: D269G

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111498
Gene: ENSMUSG00000024302
AA Change: D269G

DomainStartEndE-ValueType
Pfam:EF-hand_2 16 140 1.7e-37 PFAM
Pfam:EF-hand_3 144 232 1.6e-32 PFAM
ZnF_ZZ 237 282 1.29e-17 SMART
SCOP:d1eq1a_ 361 494 5e-3 SMART
low complexity region 499 514 N/A INTRINSIC
coiled coil region 650 677 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220904
AA Change: D269G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000221880
AA Change: D269G

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dystrobrevin subfamily of the dystrophin family. This protein is a component of the dystrophin-associated protein complex (DPC), which consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Mutations in this gene are associated with left ventricular noncompaction with congenital heart defects. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutants exhibit skeletal and cardiac myopathies. Neuromuscular junctions appear to form normally, but their postnatal maturation is compromised. Dtna mutations do not increase the severity of Dmd or Utrn mutants whose products are also part of the dystrophin-glycoprotein complex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik G A 8: 106,436,505 (GRCm39) G234S probably damaging Het
Aipl1 C T 11: 71,928,253 (GRCm39) G11D probably damaging Het
Aldh8a1 A G 10: 21,253,281 (GRCm39) I14M probably damaging Het
Arhgap11a A G 2: 113,670,125 (GRCm39) S333P possibly damaging Het
Atp1b3 A T 9: 96,220,754 (GRCm39) D180E probably benign Het
B3gnt8 T C 7: 25,328,089 (GRCm39) L173P probably damaging Het
Cabin1 A G 10: 75,590,185 (GRCm39) F37S probably damaging Het
Carmil3 G T 14: 55,741,293 (GRCm39) probably null Het
Cfi G T 3: 129,659,024 (GRCm39) M327I probably benign Het
Cltc G A 11: 86,593,237 (GRCm39) S1542F probably benign Het
Col7a1 G A 9: 108,789,350 (GRCm39) G854D unknown Het
Cux1 A T 5: 136,282,919 (GRCm39) probably null Het
Dcdc2c G T 12: 28,602,234 (GRCm39) N23K probably damaging Het
Dclre1a A G 19: 56,528,734 (GRCm39) I807T probably damaging Het
Dnah14 T C 1: 181,502,007 (GRCm39) F1770L probably benign Het
Dnajc13 A G 9: 104,115,726 (GRCm39) F28L probably benign Het
Dusp4 G T 8: 35,274,822 (GRCm39) probably benign Het
Ece1 T C 4: 137,641,133 (GRCm39) S19P probably benign Het
Gas1 T C 13: 60,323,905 (GRCm39) D243G possibly damaging Het
Ggnbp2 A G 11: 84,744,989 (GRCm39) C178R probably benign Het
Gm12185 T A 11: 48,806,408 (GRCm39) N261I probably benign Het
Grm4 A T 17: 27,669,183 (GRCm39) F362I possibly damaging Het
Icos T A 1: 61,032,871 (GRCm39) N23K probably benign Het
Kcnk2 CAAA CAA 1: 188,988,891 (GRCm39) probably null Het
Krt5 T C 15: 101,620,153 (GRCm39) K188R probably damaging Het
Mindy3 C T 2: 12,361,715 (GRCm39) probably null Het
Ncdn C T 4: 126,645,795 (GRCm39) R38H probably damaging Het
Nol9 A G 4: 152,125,706 (GRCm39) K219R probably benign Het
Opalin A T 19: 41,060,668 (GRCm39) S2R probably damaging Het
Or8g35 A T 9: 39,381,201 (GRCm39) S274T probably damaging Het
Pask G A 1: 93,263,390 (GRCm39) S122L probably benign Het
Pcdha11 T C 18: 37,140,176 (GRCm39) S602P probably damaging Het
Pclo A G 5: 14,816,753 (GRCm39) K1271R Het
Piezo1 T C 8: 123,224,214 (GRCm39) H763R Het
Pigr A G 1: 130,777,350 (GRCm39) K719E probably benign Het
Piwil4 A T 9: 14,638,790 (GRCm39) V245E probably damaging Het
Plcb4 A G 2: 135,829,444 (GRCm39) M925V probably benign Het
Pomt1 G A 2: 32,133,543 (GRCm39) probably null Het
Pou2f2 C A 7: 24,796,569 (GRCm39) A302S probably benign Het
Rapgef4 A T 2: 72,026,052 (GRCm39) H359L probably damaging Het
Rfesd C T 13: 76,156,299 (GRCm39) V36I possibly damaging Het
Rims1 G A 1: 22,523,823 (GRCm39) T421M probably damaging Het
Serpinf2 T A 11: 75,327,615 (GRCm39) H150L probably benign Het
Syt10 A T 15: 89,675,122 (GRCm39) M408K possibly damaging Het
Tcea1 T A 1: 4,961,021 (GRCm39) probably null Het
Tia1 T C 6: 86,407,347 (GRCm39) *387R probably null Het
Top3a A C 11: 60,647,517 (GRCm39) V186G probably damaging Het
Upk3b T A 5: 136,067,736 (GRCm39) S27R unknown Het
Usp18 A G 6: 121,239,726 (GRCm39) S274G probably benign Het
Vmn1r230 C A 17: 21,067,163 (GRCm39) C117* probably null Het
Vmn1r72 T C 7: 11,404,347 (GRCm39) I34V probably benign Het
Vmn2r74 T C 7: 85,606,101 (GRCm39) D415G probably benign Het
Zfp54 A G 17: 21,655,186 (GRCm39) Y560C probably damaging Het
Other mutations in Dtna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Dtna APN 18 23,730,545 (GRCm39) missense probably benign 0.22
IGL01620:Dtna APN 18 23,758,144 (GRCm39) missense probably damaging 1.00
IGL01705:Dtna APN 18 23,678,788 (GRCm39) missense probably damaging 1.00
IGL01914:Dtna APN 18 23,730,516 (GRCm39) missense possibly damaging 0.62
IGL02388:Dtna APN 18 23,730,571 (GRCm39) missense probably benign 0.00
IGL02427:Dtna APN 18 23,784,595 (GRCm39) missense possibly damaging 0.95
IGL03074:Dtna APN 18 23,735,662 (GRCm39) missense possibly damaging 0.74
R0041:Dtna UTSW 18 23,779,932 (GRCm39) unclassified probably benign
R0041:Dtna UTSW 18 23,779,932 (GRCm39) unclassified probably benign
R0078:Dtna UTSW 18 23,754,499 (GRCm39) missense probably damaging 1.00
R0390:Dtna UTSW 18 23,730,558 (GRCm39) missense probably damaging 1.00
R1808:Dtna UTSW 18 23,702,697 (GRCm39) missense probably damaging 1.00
R1872:Dtna UTSW 18 23,730,617 (GRCm39) critical splice donor site probably null
R2095:Dtna UTSW 18 23,702,805 (GRCm39) missense probably damaging 1.00
R2216:Dtna UTSW 18 23,702,622 (GRCm39) missense probably damaging 1.00
R2295:Dtna UTSW 18 23,764,469 (GRCm39) missense probably damaging 1.00
R2402:Dtna UTSW 18 23,728,535 (GRCm39) nonsense probably null
R2846:Dtna UTSW 18 23,784,560 (GRCm39) splice site probably null
R3836:Dtna UTSW 18 23,758,159 (GRCm39) missense probably damaging 1.00
R4764:Dtna UTSW 18 23,668,206 (GRCm39) splice site probably null
R4893:Dtna UTSW 18 23,702,724 (GRCm39) missense probably damaging 0.99
R5194:Dtna UTSW 18 23,723,302 (GRCm39) nonsense probably null
R5373:Dtna UTSW 18 23,784,670 (GRCm39) missense probably damaging 1.00
R5374:Dtna UTSW 18 23,784,670 (GRCm39) missense probably damaging 1.00
R5526:Dtna UTSW 18 23,779,287 (GRCm39) missense probably damaging 0.99
R5755:Dtna UTSW 18 23,754,520 (GRCm39) missense probably benign
R5769:Dtna UTSW 18 23,784,611 (GRCm39) missense probably benign 0.27
R6062:Dtna UTSW 18 23,755,113 (GRCm39) missense possibly damaging 0.87
R6413:Dtna UTSW 18 23,755,071 (GRCm39) missense probably damaging 1.00
R6876:Dtna UTSW 18 23,744,167 (GRCm39) missense probably benign 0.00
R7103:Dtna UTSW 18 23,786,436 (GRCm39) critical splice donor site probably null
R7711:Dtna UTSW 18 23,758,253 (GRCm39) critical splice donor site probably null
R7804:Dtna UTSW 18 23,728,666 (GRCm39) missense probably damaging 0.97
R8156:Dtna UTSW 18 23,723,388 (GRCm39) nonsense probably null
R8437:Dtna UTSW 18 23,723,398 (GRCm39) nonsense probably null
R8786:Dtna UTSW 18 23,716,190 (GRCm39) missense probably benign 0.10
R9038:Dtna UTSW 18 23,743,553 (GRCm39) missense probably benign
R9268:Dtna UTSW 18 23,702,643 (GRCm39) missense possibly damaging 0.93
R9416:Dtna UTSW 18 23,780,112 (GRCm39) critical splice donor site probably null
R9605:Dtna UTSW 18 23,764,454 (GRCm39) missense probably damaging 1.00
R9638:Dtna UTSW 18 23,744,122 (GRCm39) missense probably benign
X0063:Dtna UTSW 18 23,776,225 (GRCm39) missense probably damaging 0.98
X0066:Dtna UTSW 18 23,726,038 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CGCTTCTCTCAGTCAAAATAGATC -3'
(R):5'- GCTTTGGCCAACAGAGACAC -3'

Sequencing Primer
(F):5'- TAGATCATGGTCTGAAATCAGCAG -3'
(R):5'- ACCTACACCACCCTGAAATTCTTCTC -3'
Posted On 2022-08-09