Incidental Mutation 'R9579:Dnah2'
ID 722470
Institutional Source Beutler Lab
Gene Symbol Dnah2
Ensembl Gene ENSMUSG00000005237
Gene Name dynein, axonemal, heavy chain 2
Synonyms 2900022L05Rik, D330014H01Rik, Dnahc2, Dnhd3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9579 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 69311635-69439934 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 69368041 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1766 (L1766P)
Ref Sequence ENSEMBL: ENSMUSP00000104299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000035539
AA Change: L1760P

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237
AA Change: L1760P

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 273 429 6.6e-37 PFAM
Pfam:DHC_N1 432 761 1.3e-54 PFAM
Pfam:DHC_N2 1253 1668 3.4e-144 PFAM
AAA 1826 1962 2.95e-1 SMART
Pfam:AAA_5 2108 2251 1.3e-5 PFAM
AAA 2437 2584 3.63e-5 SMART
Pfam:AAA_8 2752 3022 1.1e-75 PFAM
Pfam:MT 3034 3370 8.7e-55 PFAM
Pfam:AAA_9 3386 3616 7.4e-68 PFAM
Pfam:Dynein_heavy 3748 4453 1.2e-220 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108659
AA Change: L1766P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237
AA Change: L1766P

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 274 429 1.1e-47 PFAM
Pfam:DHC_N1 438 760 1.5e-75 PFAM
Pfam:DHC_N2 1255 1666 4.4e-144 PFAM
low complexity region 1711 1720 N/A INTRINSIC
AAA 1832 1968 2.95e-1 SMART
Blast:AAA 2111 2251 2e-86 BLAST
AAA 2443 2590 3.63e-5 SMART
Pfam:AAA_8 2758 3028 5.5e-77 PFAM
Pfam:MT 3040 3376 7.6e-55 PFAM
Pfam:AAA_9 3396 3621 7.5e-94 PFAM
Pfam:Dynein_heavy 3759 4458 4.9e-264 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 C A 11: 46,009,262 (GRCm39) H229N probably benign Het
Ak9 C A 10: 41,213,576 (GRCm39) H260Q Het
Akap3 G A 6: 126,850,974 (GRCm39) V831I probably damaging Het
Arhgap45 T C 10: 79,853,843 (GRCm39) F119S probably benign Het
Best3 A G 10: 116,829,100 (GRCm39) T127A probably damaging Het
Ccdc7a G A 8: 129,774,134 (GRCm39) Q134* probably null Het
Ceacam5 C A 7: 17,479,561 (GRCm39) S226Y probably damaging Het
Creb3l1 C T 2: 91,822,231 (GRCm39) probably null Het
Cul4a G A 8: 13,186,147 (GRCm39) E450K probably damaging Het
Cyb5a A T 18: 84,891,273 (GRCm39) R89S probably benign Het
Gbp4 T C 5: 105,270,947 (GRCm39) E228G probably damaging Het
Ghr A G 15: 3,349,612 (GRCm39) I522T probably benign Het
Gm5225 A C 17: 24,242,897 (GRCm39) H22P possibly damaging Het
Herc2 T A 7: 55,758,500 (GRCm39) C796S probably damaging Het
Hmgxb4 G T 8: 75,756,638 (GRCm39) A588S probably damaging Het
Lats2 G A 14: 57,937,191 (GRCm39) P433S probably damaging Het
Lrfn1 C T 7: 28,166,769 (GRCm39) T721I probably damaging Het
Matcap1 A T 8: 106,012,379 (GRCm39) S23T probably benign Het
Mpzl3 G A 9: 44,973,350 (GRCm39) V30I probably benign Het
Or2r3 A T 6: 42,448,574 (GRCm39) C179* probably null Het
Pcdh15 A G 10: 74,457,117 (GRCm39) Y1298C possibly damaging Het
Plcd4 C A 1: 74,596,948 (GRCm39) H397N probably benign Het
Pnn G A 12: 59,117,030 (GRCm39) A201T possibly damaging Het
Ptprd C G 4: 75,872,315 (GRCm39) A1134P possibly damaging Het
Rabl3 T C 16: 37,362,230 (GRCm39) V23A probably damaging Het
Rnf157 T C 11: 116,240,822 (GRCm39) N423S probably benign Het
Rtn1 T C 12: 72,270,289 (GRCm39) D601G probably damaging Het
Rxfp1 A G 3: 79,557,946 (GRCm39) Y511H probably damaging Het
Sema5b T C 16: 35,467,582 (GRCm39) M282T probably benign Het
Slco5a1 G T 1: 12,949,383 (GRCm39) S669* probably null Het
Sphkap C G 1: 83,255,295 (GRCm39) G818A probably damaging Het
Stk26 C T X: 49,930,618 (GRCm39) probably benign Het
Syne3 T C 12: 104,942,107 (GRCm39) S12G probably damaging Het
Tmem150a C A 6: 72,334,070 (GRCm39) Q51K probably benign Het
Ttn C T 2: 76,550,196 (GRCm39) D31662N probably damaging Het
Ttn C T 2: 76,578,602 (GRCm39) G24097D probably damaging Het
Tubb4b T C 2: 25,114,139 (GRCm39) T55A probably benign Het
Vcan A T 13: 89,837,713 (GRCm39) D2610E possibly damaging Het
Xkr5 T C 8: 18,983,785 (GRCm39) T586A probably benign Het
Zfp260 T C 7: 29,805,108 (GRCm39) F336S Het
Zic1 A G 9: 91,246,790 (GRCm39) F94S probably damaging Het
Other mutations in Dnah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dnah2 APN 11 69,383,498 (GRCm39) missense possibly damaging 0.93
IGL00418:Dnah2 APN 11 69,385,892 (GRCm39) splice site probably benign
IGL00772:Dnah2 APN 11 69,342,083 (GRCm39) missense probably damaging 0.97
IGL00819:Dnah2 APN 11 69,364,176 (GRCm39) critical splice donor site probably null
IGL00827:Dnah2 APN 11 69,339,283 (GRCm39) missense probably damaging 1.00
IGL01060:Dnah2 APN 11 69,368,918 (GRCm39) missense possibly damaging 0.86
IGL01340:Dnah2 APN 11 69,384,010 (GRCm39) missense probably damaging 0.99
IGL01349:Dnah2 APN 11 69,366,432 (GRCm39) missense probably damaging 0.99
IGL01413:Dnah2 APN 11 69,323,790 (GRCm39) missense probably damaging 0.99
IGL01451:Dnah2 APN 11 69,365,017 (GRCm39) splice site probably benign
IGL01480:Dnah2 APN 11 69,349,197 (GRCm39) missense possibly damaging 0.91
IGL01537:Dnah2 APN 11 69,406,906 (GRCm39) missense probably benign 0.17
IGL01592:Dnah2 APN 11 69,321,913 (GRCm39) missense probably benign 0.14
IGL01612:Dnah2 APN 11 69,355,889 (GRCm39) splice site probably benign
IGL01667:Dnah2 APN 11 69,435,221 (GRCm39) missense probably benign
IGL01667:Dnah2 APN 11 69,411,767 (GRCm39) missense probably damaging 0.98
IGL01691:Dnah2 APN 11 69,430,269 (GRCm39) missense probably benign
IGL02019:Dnah2 APN 11 69,365,111 (GRCm39) missense probably damaging 1.00
IGL02039:Dnah2 APN 11 69,390,038 (GRCm39) missense probably damaging 1.00
IGL02076:Dnah2 APN 11 69,313,385 (GRCm39) missense probably damaging 0.99
IGL02085:Dnah2 APN 11 69,349,011 (GRCm39) missense probably benign 0.07
IGL02158:Dnah2 APN 11 69,348,949 (GRCm39) missense probably benign
IGL02381:Dnah2 APN 11 69,337,118 (GRCm39) missense probably benign 0.25
IGL02681:Dnah2 APN 11 69,343,759 (GRCm39) missense probably benign 0.40
IGL02957:Dnah2 APN 11 69,339,333 (GRCm39) missense possibly damaging 0.96
IGL02961:Dnah2 APN 11 69,409,240 (GRCm39) missense probably damaging 1.00
IGL02969:Dnah2 APN 11 69,412,013 (GRCm39) missense possibly damaging 0.80
IGL03117:Dnah2 APN 11 69,327,117 (GRCm39) splice site probably benign
IGL03120:Dnah2 APN 11 69,312,674 (GRCm39) missense probably damaging 1.00
IGL03183:Dnah2 APN 11 69,349,314 (GRCm39) missense possibly damaging 0.94
IGL03197:Dnah2 APN 11 69,350,089 (GRCm39) missense probably damaging 1.00
IGL03263:Dnah2 APN 11 69,420,207 (GRCm39) critical splice donor site probably null
IGL03333:Dnah2 APN 11 69,385,949 (GRCm39) missense probably damaging 1.00
IGL03338:Dnah2 APN 11 69,387,403 (GRCm39) missense probably benign 0.13
argyrios UTSW 11 69,407,416 (GRCm39) missense possibly damaging 0.47
Aureus UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
platinum UTSW 11 69,348,868 (GRCm39) missense probably damaging 0.96
R0334_dnah2_144 UTSW 11 69,327,662 (GRCm39) missense probably damaging 1.00
R2150_dnah2_212 UTSW 11 69,406,587 (GRCm39) missense probably benign 0.14
BB005:Dnah2 UTSW 11 69,321,661 (GRCm39) missense probably damaging 0.98
BB015:Dnah2 UTSW 11 69,321,661 (GRCm39) missense probably damaging 0.98
E0370:Dnah2 UTSW 11 69,406,441 (GRCm39) splice site probably null
P0026:Dnah2 UTSW 11 69,355,773 (GRCm39) missense probably damaging 1.00
R0133:Dnah2 UTSW 11 69,311,835 (GRCm39) missense probably damaging 1.00
R0190:Dnah2 UTSW 11 69,326,075 (GRCm39) missense probably damaging 1.00
R0334:Dnah2 UTSW 11 69,327,662 (GRCm39) missense probably damaging 1.00
R0359:Dnah2 UTSW 11 69,420,357 (GRCm39) missense probably benign 0.00
R0386:Dnah2 UTSW 11 69,338,687 (GRCm39) missense probably damaging 1.00
R0414:Dnah2 UTSW 11 69,390,064 (GRCm39) missense probably benign 0.26
R0427:Dnah2 UTSW 11 69,343,705 (GRCm39) missense probably damaging 0.99
R0433:Dnah2 UTSW 11 69,350,114 (GRCm39) missense probably damaging 1.00
R0442:Dnah2 UTSW 11 69,339,368 (GRCm39) missense probably damaging 1.00
R0462:Dnah2 UTSW 11 69,350,027 (GRCm39) missense probably damaging 1.00
R0463:Dnah2 UTSW 11 69,313,952 (GRCm39) missense probably damaging 1.00
R0611:Dnah2 UTSW 11 69,390,020 (GRCm39) missense probably damaging 1.00
R0626:Dnah2 UTSW 11 69,368,509 (GRCm39) missense probably benign 0.07
R0924:Dnah2 UTSW 11 69,312,134 (GRCm39) missense probably damaging 1.00
R0968:Dnah2 UTSW 11 69,339,345 (GRCm39) missense possibly damaging 0.67
R1066:Dnah2 UTSW 11 69,338,645 (GRCm39) missense probably damaging 1.00
R1183:Dnah2 UTSW 11 69,337,474 (GRCm39) missense possibly damaging 0.95
R1184:Dnah2 UTSW 11 69,390,016 (GRCm39) missense probably damaging 1.00
R1186:Dnah2 UTSW 11 69,406,526 (GRCm39) missense probably damaging 0.99
R1453:Dnah2 UTSW 11 69,341,876 (GRCm39) missense probably damaging 0.99
R1498:Dnah2 UTSW 11 69,411,493 (GRCm39) splice site probably null
R1538:Dnah2 UTSW 11 69,368,028 (GRCm39) missense probably benign 0.17
R1574:Dnah2 UTSW 11 69,405,514 (GRCm39) missense probably benign 0.26
R1574:Dnah2 UTSW 11 69,405,514 (GRCm39) missense probably benign 0.26
R1590:Dnah2 UTSW 11 69,412,024 (GRCm39) missense probably benign 0.00
R1590:Dnah2 UTSW 11 69,313,580 (GRCm39) critical splice donor site probably null
R1655:Dnah2 UTSW 11 69,364,680 (GRCm39) missense probably damaging 1.00
R1695:Dnah2 UTSW 11 69,405,517 (GRCm39) missense possibly damaging 0.74
R1726:Dnah2 UTSW 11 69,388,715 (GRCm39) missense probably damaging 1.00
R1764:Dnah2 UTSW 11 69,314,369 (GRCm39) missense probably damaging 1.00
R1815:Dnah2 UTSW 11 69,366,400 (GRCm39) missense probably damaging 1.00
R1822:Dnah2 UTSW 11 69,405,630 (GRCm39) missense probably damaging 1.00
R1859:Dnah2 UTSW 11 69,328,712 (GRCm39) missense probably damaging 0.99
R1911:Dnah2 UTSW 11 69,406,578 (GRCm39) missense possibly damaging 0.64
R1913:Dnah2 UTSW 11 69,355,756 (GRCm39) missense probably damaging 1.00
R1981:Dnah2 UTSW 11 69,365,151 (GRCm39) missense probably damaging 1.00
R2010:Dnah2 UTSW 11 69,349,184 (GRCm39) critical splice donor site probably null
R2016:Dnah2 UTSW 11 69,327,896 (GRCm39) missense probably damaging 0.97
R2017:Dnah2 UTSW 11 69,327,896 (GRCm39) missense probably damaging 0.97
R2044:Dnah2 UTSW 11 69,415,066 (GRCm39) missense probably benign 0.14
R2077:Dnah2 UTSW 11 69,387,432 (GRCm39) missense possibly damaging 0.73
R2096:Dnah2 UTSW 11 69,346,742 (GRCm39) missense probably damaging 0.98
R2099:Dnah2 UTSW 11 69,384,063 (GRCm39) missense probably damaging 1.00
R2127:Dnah2 UTSW 11 69,349,011 (GRCm39) missense probably benign 0.02
R2128:Dnah2 UTSW 11 69,349,011 (GRCm39) missense probably benign 0.02
R2146:Dnah2 UTSW 11 69,406,587 (GRCm39) missense probably benign 0.14
R2147:Dnah2 UTSW 11 69,406,587 (GRCm39) missense probably benign 0.14
R2150:Dnah2 UTSW 11 69,406,587 (GRCm39) missense probably benign 0.14
R2404:Dnah2 UTSW 11 69,328,047 (GRCm39) missense probably damaging 0.99
R2510:Dnah2 UTSW 11 69,415,032 (GRCm39) nonsense probably null
R2517:Dnah2 UTSW 11 69,407,470 (GRCm39) missense probably damaging 1.00
R3014:Dnah2 UTSW 11 69,321,304 (GRCm39) missense probably benign
R3741:Dnah2 UTSW 11 69,339,295 (GRCm39) missense probably damaging 1.00
R3814:Dnah2 UTSW 11 69,383,476 (GRCm39) splice site probably null
R3872:Dnah2 UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
R3873:Dnah2 UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
R3874:Dnah2 UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
R3875:Dnah2 UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
R3881:Dnah2 UTSW 11 69,342,173 (GRCm39) missense possibly damaging 0.94
R3953:Dnah2 UTSW 11 69,344,929 (GRCm39) missense probably damaging 1.00
R3956:Dnah2 UTSW 11 69,374,847 (GRCm39) missense probably benign 0.00
R4501:Dnah2 UTSW 11 69,368,485 (GRCm39) missense probably benign
R4515:Dnah2 UTSW 11 69,356,457 (GRCm39) missense possibly damaging 0.61
R4612:Dnah2 UTSW 11 69,374,193 (GRCm39) missense possibly damaging 0.93
R4625:Dnah2 UTSW 11 69,354,487 (GRCm39) missense probably damaging 1.00
R4627:Dnah2 UTSW 11 69,356,202 (GRCm39) missense probably damaging 1.00
R4642:Dnah2 UTSW 11 69,387,385 (GRCm39) missense probably benign 0.00
R4683:Dnah2 UTSW 11 69,349,768 (GRCm39) missense probably damaging 1.00
R4698:Dnah2 UTSW 11 69,389,358 (GRCm39) missense probably damaging 1.00
R4710:Dnah2 UTSW 11 69,368,903 (GRCm39) missense probably damaging 1.00
R4712:Dnah2 UTSW 11 69,407,416 (GRCm39) missense possibly damaging 0.47
R4713:Dnah2 UTSW 11 69,367,514 (GRCm39) missense probably damaging 1.00
R4717:Dnah2 UTSW 11 69,320,183 (GRCm39) missense probably benign 0.00
R4740:Dnah2 UTSW 11 69,348,868 (GRCm39) missense probably damaging 0.96
R4780:Dnah2 UTSW 11 69,364,697 (GRCm39) missense probably damaging 0.97
R4825:Dnah2 UTSW 11 69,314,031 (GRCm39) missense probably damaging 1.00
R4864:Dnah2 UTSW 11 69,313,416 (GRCm39) missense probably damaging 0.98
R4868:Dnah2 UTSW 11 69,354,474 (GRCm39) missense probably damaging 1.00
R4879:Dnah2 UTSW 11 69,367,517 (GRCm39) missense probably damaging 1.00
R4908:Dnah2 UTSW 11 69,411,973 (GRCm39) missense probably benign 0.00
R4911:Dnah2 UTSW 11 69,389,930 (GRCm39) critical splice donor site probably null
R4954:Dnah2 UTSW 11 69,430,322 (GRCm39) missense possibly damaging 0.61
R4962:Dnah2 UTSW 11 69,346,799 (GRCm39) nonsense probably null
R5015:Dnah2 UTSW 11 69,388,708 (GRCm39) missense possibly damaging 0.89
R5049:Dnah2 UTSW 11 69,338,992 (GRCm39) missense probably damaging 1.00
R5055:Dnah2 UTSW 11 69,411,599 (GRCm39) missense possibly damaging 0.67
R5153:Dnah2 UTSW 11 69,411,759 (GRCm39) missense possibly damaging 0.84
R5155:Dnah2 UTSW 11 69,313,362 (GRCm39) missense probably damaging 1.00
R5186:Dnah2 UTSW 11 69,326,710 (GRCm39) missense probably damaging 1.00
R5187:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5208:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5252:Dnah2 UTSW 11 69,420,295 (GRCm39) missense probably damaging 0.98
R5296:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5298:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5299:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5301:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5324:Dnah2 UTSW 11 69,348,819 (GRCm39) missense probably benign 0.07
R5350:Dnah2 UTSW 11 69,406,862 (GRCm39) missense possibly damaging 0.48
R5377:Dnah2 UTSW 11 69,312,674 (GRCm39) missense probably damaging 1.00
R5393:Dnah2 UTSW 11 69,391,683 (GRCm39) missense probably benign
R5421:Dnah2 UTSW 11 69,326,462 (GRCm39) missense probably damaging 1.00
R5452:Dnah2 UTSW 11 69,415,209 (GRCm39) missense probably damaging 1.00
R5461:Dnah2 UTSW 11 69,364,177 (GRCm39) critical splice donor site probably null
R5474:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5476:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5477:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5510:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5527:Dnah2 UTSW 11 69,328,014 (GRCm39) nonsense probably null
R5566:Dnah2 UTSW 11 69,407,395 (GRCm39) nonsense probably null
R5587:Dnah2 UTSW 11 69,328,068 (GRCm39) missense probably damaging 1.00
R5628:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5688:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5690:Dnah2 UTSW 11 69,382,370 (GRCm39) missense probably benign 0.15
R5711:Dnah2 UTSW 11 69,326,216 (GRCm39) missense probably damaging 1.00
R5735:Dnah2 UTSW 11 69,321,643 (GRCm39) missense possibly damaging 0.93
R5826:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5913:Dnah2 UTSW 11 69,339,256 (GRCm39) missense probably damaging 1.00
R5914:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5960:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5961:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5961:Dnah2 UTSW 11 69,321,974 (GRCm39) missense probably damaging 1.00
R5977:Dnah2 UTSW 11 69,411,707 (GRCm39) missense possibly damaging 0.79
R6020:Dnah2 UTSW 11 69,391,665 (GRCm39) missense probably benign
R6036:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R6036:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R6050:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R6086:Dnah2 UTSW 11 69,406,834 (GRCm39) missense probably benign 0.30
R6115:Dnah2 UTSW 11 69,337,475 (GRCm39) missense probably damaging 1.00
R6123:Dnah2 UTSW 11 69,409,185 (GRCm39) missense probably benign 0.29
R6159:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R6159:Dnah2 UTSW 11 69,349,368 (GRCm39) missense probably damaging 1.00
R6163:Dnah2 UTSW 11 69,411,729 (GRCm39) nonsense probably null
R6171:Dnah2 UTSW 11 69,313,868 (GRCm39) missense probably damaging 1.00
R6263:Dnah2 UTSW 11 69,348,238 (GRCm39) missense probably damaging 1.00
R6298:Dnah2 UTSW 11 69,382,467 (GRCm39) missense probably benign 0.25
R6352:Dnah2 UTSW 11 69,339,053 (GRCm39) missense probably damaging 1.00
R6399:Dnah2 UTSW 11 69,349,344 (GRCm39) missense probably damaging 0.98
R6466:Dnah2 UTSW 11 69,430,241 (GRCm39) missense probably benign
R6478:Dnah2 UTSW 11 69,406,836 (GRCm39) missense probably benign 0.01
R6516:Dnah2 UTSW 11 69,356,212 (GRCm39) missense probably benign 0.34
R6538:Dnah2 UTSW 11 69,328,023 (GRCm39) missense possibly damaging 0.87
R6802:Dnah2 UTSW 11 69,314,516 (GRCm39) missense probably damaging 1.00
R6861:Dnah2 UTSW 11 69,346,789 (GRCm39) missense possibly damaging 0.64
R6869:Dnah2 UTSW 11 69,320,297 (GRCm39) missense probably damaging 1.00
R6894:Dnah2 UTSW 11 69,375,086 (GRCm39) missense probably benign 0.12
R6935:Dnah2 UTSW 11 69,312,567 (GRCm39) missense probably damaging 1.00
R7017:Dnah2 UTSW 11 69,382,373 (GRCm39) nonsense probably null
R7073:Dnah2 UTSW 11 69,321,318 (GRCm39) nonsense probably null
R7111:Dnah2 UTSW 11 69,337,579 (GRCm39) splice site probably null
R7125:Dnah2 UTSW 11 69,327,008 (GRCm39) missense probably damaging 0.99
R7137:Dnah2 UTSW 11 69,382,381 (GRCm39) missense probably damaging 1.00
R7190:Dnah2 UTSW 11 69,439,923 (GRCm39) splice site probably null
R7214:Dnah2 UTSW 11 69,321,935 (GRCm39) missense probably damaging 1.00
R7227:Dnah2 UTSW 11 69,312,222 (GRCm39) missense probably damaging 0.99
R7238:Dnah2 UTSW 11 69,349,972 (GRCm39) critical splice donor site probably null
R7256:Dnah2 UTSW 11 69,321,920 (GRCm39) missense probably damaging 1.00
R7267:Dnah2 UTSW 11 69,391,643 (GRCm39) missense probably damaging 1.00
R7420:Dnah2 UTSW 11 69,369,623 (GRCm39) missense possibly damaging 0.94
R7421:Dnah2 UTSW 11 69,383,631 (GRCm39) missense probably benign 0.25
R7437:Dnah2 UTSW 11 69,389,453 (GRCm39) missense probably damaging 1.00
R7461:Dnah2 UTSW 11 69,439,816 (GRCm39) critical splice donor site probably null
R7473:Dnah2 UTSW 11 69,382,484 (GRCm39) missense probably damaging 0.99
R7528:Dnah2 UTSW 11 69,391,622 (GRCm39) missense probably damaging 0.99
R7613:Dnah2 UTSW 11 69,439,816 (GRCm39) critical splice donor site probably null
R7615:Dnah2 UTSW 11 69,326,130 (GRCm39) missense probably damaging 0.99
R7626:Dnah2 UTSW 11 69,389,511 (GRCm39) missense probably damaging 0.99
R7745:Dnah2 UTSW 11 69,342,144 (GRCm39) nonsense probably null
R7764:Dnah2 UTSW 11 69,348,984 (GRCm39) missense probably benign 0.29
R7793:Dnah2 UTSW 11 69,386,040 (GRCm39) missense probably benign 0.00
R7819:Dnah2 UTSW 11 69,407,419 (GRCm39) missense probably benign 0.01
R7881:Dnah2 UTSW 11 69,322,064 (GRCm39) missense probably damaging 1.00
R7900:Dnah2 UTSW 11 69,409,254 (GRCm39) missense probably damaging 1.00
R7916:Dnah2 UTSW 11 69,311,974 (GRCm39) critical splice acceptor site probably null
R7921:Dnah2 UTSW 11 69,411,660 (GRCm39) missense probably benign
R7928:Dnah2 UTSW 11 69,321,661 (GRCm39) missense probably damaging 0.98
R7937:Dnah2 UTSW 11 69,408,511 (GRCm39) nonsense probably null
R7995:Dnah2 UTSW 11 69,411,563 (GRCm39) missense possibly damaging 0.77
R8202:Dnah2 UTSW 11 69,369,649 (GRCm39) missense probably benign 0.00
R8208:Dnah2 UTSW 11 69,411,678 (GRCm39) missense probably benign 0.05
R8215:Dnah2 UTSW 11 69,326,193 (GRCm39) missense probably damaging 1.00
R8279:Dnah2 UTSW 11 69,366,399 (GRCm39) missense probably damaging 1.00
R8338:Dnah2 UTSW 11 69,378,122 (GRCm39) missense probably damaging 1.00
R8348:Dnah2 UTSW 11 69,320,273 (GRCm39) missense possibly damaging 0.95
R8405:Dnah2 UTSW 11 69,349,289 (GRCm39) missense probably damaging 1.00
R8407:Dnah2 UTSW 11 69,350,104 (GRCm39) missense probably benign 0.00
R8493:Dnah2 UTSW 11 69,343,804 (GRCm39) missense probably damaging 1.00
R8673:Dnah2 UTSW 11 69,405,523 (GRCm39) missense probably benign 0.23
R8725:Dnah2 UTSW 11 69,415,005 (GRCm39) missense probably damaging 1.00
R8727:Dnah2 UTSW 11 69,415,005 (GRCm39) missense probably damaging 1.00
R8730:Dnah2 UTSW 11 69,384,087 (GRCm39) missense possibly damaging 0.73
R8804:Dnah2 UTSW 11 69,356,511 (GRCm39) missense probably benign 0.01
R8876:Dnah2 UTSW 11 69,382,348 (GRCm39) missense probably damaging 1.00
R8894:Dnah2 UTSW 11 69,383,048 (GRCm39) missense probably benign 0.01
R8938:Dnah2 UTSW 11 69,328,754 (GRCm39) missense probably damaging 0.99
R9044:Dnah2 UTSW 11 69,420,247 (GRCm39) missense probably benign
R9085:Dnah2 UTSW 11 69,320,224 (GRCm39) missense possibly damaging 0.69
R9110:Dnah2 UTSW 11 69,435,208 (GRCm39) missense probably benign
R9156:Dnah2 UTSW 11 69,313,687 (GRCm39) missense
R9251:Dnah2 UTSW 11 69,406,619 (GRCm39) missense probably damaging 1.00
R9258:Dnah2 UTSW 11 69,368,079 (GRCm39) missense probably damaging 1.00
R9279:Dnah2 UTSW 11 69,409,104 (GRCm39) missense probably benign 0.01
R9318:Dnah2 UTSW 11 69,375,155 (GRCm39) missense probably benign 0.07
R9321:Dnah2 UTSW 11 69,338,939 (GRCm39) critical splice donor site probably null
R9350:Dnah2 UTSW 11 69,384,073 (GRCm39) missense probably benign 0.10
R9358:Dnah2 UTSW 11 69,406,592 (GRCm39) missense probably damaging 0.99
R9417:Dnah2 UTSW 11 69,326,990 (GRCm39) missense probably damaging 1.00
R9420:Dnah2 UTSW 11 69,368,942 (GRCm39) missense probably benign 0.09
R9438:Dnah2 UTSW 11 69,364,220 (GRCm39) missense probably damaging 1.00
R9469:Dnah2 UTSW 11 69,321,896 (GRCm39) missense probably damaging 1.00
R9487:Dnah2 UTSW 11 69,406,617 (GRCm39) missense possibly damaging 0.47
R9495:Dnah2 UTSW 11 69,345,208 (GRCm39) missense possibly damaging 0.89
R9608:Dnah2 UTSW 11 69,344,888 (GRCm39) missense probably null 1.00
R9651:Dnah2 UTSW 11 69,341,824 (GRCm39) critical splice donor site probably null
R9662:Dnah2 UTSW 11 69,343,763 (GRCm39) missense probably benign
RF004:Dnah2 UTSW 11 69,328,013 (GRCm39) missense probably benign 0.24
U24488:Dnah2 UTSW 11 69,374,648 (GRCm39) missense probably damaging 0.99
X0021:Dnah2 UTSW 11 69,339,388 (GRCm39) missense possibly damaging 0.81
Z1088:Dnah2 UTSW 11 69,321,619 (GRCm39) missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69,312,647 (GRCm39) missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69,407,349 (GRCm39) missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69,407,307 (GRCm39) missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69,389,493 (GRCm39) missense probably benign 0.12
Z1176:Dnah2 UTSW 11 69,377,880 (GRCm39) missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69,341,946 (GRCm39) missense probably benign
Z1177:Dnah2 UTSW 11 69,435,383 (GRCm39) critical splice acceptor site probably null
Z1177:Dnah2 UTSW 11 69,354,279 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TTGCCTGGAGTAACCACTGG -3'
(R):5'- AGCCTTGGCTACATTGATGCTTC -3'

Sequencing Primer
(F):5'- GGATTGCGACAGAGCTAAACCTTC -3'
(R):5'- GGCTACATTGATGCTTCTGTTC -3'
Posted On 2022-08-09