Incidental Mutation 'R9580:Nos2'
ID 722505
Institutional Source Beutler Lab
Gene Symbol Nos2
Ensembl Gene ENSMUSG00000020826
Gene Name nitric oxide synthase 2, inducible
Synonyms Nos2a, NOS-II, Nos-2, iNOS
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9580 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 78811613-78851052 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78828457 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 259 (I259V)
Ref Sequence ENSEMBL: ENSMUSP00000018610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018610] [ENSMUST00000214397]
AlphaFold P29477
PDB Structure MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DOMAIN (DELTA 114) (N-[(1,3-BENZODIOXOL-5-YL)METHYL]-1-[2-(1H-IMIDAZOL-1-YL)PYRIMIDIN-4-YL]-4-(METHOXYCARBONYL)-PIPERAZINE-2-ACETAMIDE COMPLEX [X-RAY DIFFRACTION]
MURINE INOSOXY DIMER WITH ISOTHIOUREA BOUND IN THE ACTIVE SITE [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND 4-AMINO TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND DIHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457F Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457A Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
inducible nitric oxide synthase with Chlorzoxazone bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 7-nitroindazole bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 6-nitroindazole bound [X-RAY DIFFRACTION]
>> 40 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000018610
AA Change: I259V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000018610
Gene: ENSMUSG00000020826
AA Change: I259V

DomainStartEndE-ValueType
Pfam:NO_synthase 129 491 6.7e-189 PFAM
Pfam:Flavodoxin_1 535 666 5.5e-43 PFAM
Pfam:FAD_binding_1 719 941 8.8e-79 PFAM
Pfam:NAD_binding_1 973 1087 4.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214397
AA Change: I146V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase that is inducible by a combination of lipopolysaccharide and certain cytokines. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous deletion of this gene alters susceptibility to infection, response to injury, sepsis and sensory stimuli, cardiac function, osteoclast, platelet and mammary gland physiology, tumor growth, testis and uterus morphology, diet-induced atherosclerosis, and blood, urine and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora2b T C 11: 62,156,145 (GRCm39) M198T probably damaging Het
Agbl2 A G 2: 90,636,248 (GRCm39) T595A probably benign Het
Cep89 A T 7: 35,102,538 (GRCm39) I84F possibly damaging Het
Eda G T X: 99,019,775 (GRCm39) R130L unknown Het
Erp44 T A 4: 48,218,187 (GRCm39) R161* probably null Het
Fcsk A G 8: 111,616,813 (GRCm39) W446R probably damaging Het
Gm12185 T G 11: 48,799,192 (GRCm39) S434R possibly damaging Het
Hmcn2 G T 2: 31,294,875 (GRCm39) A2555S probably benign Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Ighv1-61 A G 12: 115,322,993 (GRCm39) S40P possibly damaging Het
Kif26b C T 1: 178,506,643 (GRCm39) Q240* probably null Het
Mapkap1 C T 2: 34,509,878 (GRCm39) T456M probably damaging Het
Ncapg2 A G 12: 116,424,228 (GRCm39) N1137S probably damaging Het
Nectin4 C G 1: 171,211,324 (GRCm39) R283G probably damaging Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Or4c119 T C 2: 88,987,465 (GRCm39) N18S probably benign Het
Pgm2 A T 5: 64,265,092 (GRCm39) N371I possibly damaging Het
Ppargc1a A T 5: 51,620,139 (GRCm39) N733K unknown Het
Ptpn5 A G 7: 46,732,622 (GRCm39) Y345H probably damaging Het
Ptprd C G 4: 75,872,315 (GRCm39) A1134P possibly damaging Het
Rbm47 A C 5: 66,183,877 (GRCm39) M242R possibly damaging Het
Slc12a5 T G 2: 164,816,896 (GRCm39) F140V probably damaging Het
Slc22a2 G T 17: 12,803,177 (GRCm39) V4L probably benign Het
Stk26 C T X: 49,930,618 (GRCm39) probably benign Het
Tas2r105 A T 6: 131,663,699 (GRCm39) I243K probably damaging Het
Tmem126b G T 7: 90,118,231 (GRCm39) Y216* probably null Het
Usp25 C T 16: 76,880,682 (GRCm39) T681I probably benign Het
Vmn1r206 C T 13: 22,804,890 (GRCm39) A106T probably damaging Het
Vmn1r39 A T 6: 66,781,915 (GRCm39) N134K probably damaging Het
Vmn1r9 T C 6: 57,048,812 (GRCm39) S296P probably benign Het
Zfp97 T A 17: 17,365,243 (GRCm39) F247L probably damaging Het
Other mutations in Nos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Nos2 APN 11 78,848,278 (GRCm39) missense probably damaging 0.96
IGL01503:Nos2 APN 11 78,836,689 (GRCm39) splice site probably benign
IGL01789:Nos2 APN 11 78,835,483 (GRCm39) splice site probably benign
IGL02797:Nos2 APN 11 78,831,170 (GRCm39) missense probably damaging 1.00
IGL02968:Nos2 APN 11 78,828,463 (GRCm39) missense probably damaging 1.00
R6762_Nos2_754 UTSW 11 78,850,574 (GRCm39) missense possibly damaging 0.90
R0035:Nos2 UTSW 11 78,836,553 (GRCm39) missense probably damaging 1.00
R0265:Nos2 UTSW 11 78,828,428 (GRCm39) missense probably damaging 0.98
R0441:Nos2 UTSW 11 78,819,409 (GRCm39) missense probably benign 0.10
R0504:Nos2 UTSW 11 78,830,903 (GRCm39) missense probably damaging 1.00
R0570:Nos2 UTSW 11 78,826,187 (GRCm39) missense possibly damaging 0.49
R1356:Nos2 UTSW 11 78,843,629 (GRCm39) missense probably benign 0.00
R1538:Nos2 UTSW 11 78,847,396 (GRCm39) missense probably benign 0.00
R3414:Nos2 UTSW 11 78,848,414 (GRCm39) missense probably benign 0.14
R3418:Nos2 UTSW 11 78,850,521 (GRCm39) missense possibly damaging 0.47
R4279:Nos2 UTSW 11 78,820,602 (GRCm39) missense probably benign 0.01
R4492:Nos2 UTSW 11 78,840,921 (GRCm39) missense probably benign
R4632:Nos2 UTSW 11 78,848,417 (GRCm39) missense possibly damaging 0.95
R4686:Nos2 UTSW 11 78,819,456 (GRCm39) missense possibly damaging 0.65
R5038:Nos2 UTSW 11 78,813,140 (GRCm39) missense probably benign
R5214:Nos2 UTSW 11 78,846,267 (GRCm39) missense probably damaging 1.00
R5377:Nos2 UTSW 11 78,848,317 (GRCm39) missense probably benign 0.00
R5777:Nos2 UTSW 11 78,830,978 (GRCm39) missense probably null 1.00
R5834:Nos2 UTSW 11 78,819,405 (GRCm39) missense probably benign 0.01
R5930:Nos2 UTSW 11 78,828,741 (GRCm39) missense probably damaging 1.00
R6511:Nos2 UTSW 11 78,846,290 (GRCm39) splice site probably null
R6706:Nos2 UTSW 11 78,835,549 (GRCm39) missense possibly damaging 0.60
R6747:Nos2 UTSW 11 78,843,780 (GRCm39) missense probably damaging 0.99
R6762:Nos2 UTSW 11 78,850,574 (GRCm39) missense possibly damaging 0.90
R6817:Nos2 UTSW 11 78,836,092 (GRCm39) missense possibly damaging 0.64
R6868:Nos2 UTSW 11 78,848,332 (GRCm39) missense probably benign 0.02
R6917:Nos2 UTSW 11 78,842,053 (GRCm39) missense possibly damaging 0.50
R7082:Nos2 UTSW 11 78,819,405 (GRCm39) missense probably benign 0.02
R7286:Nos2 UTSW 11 78,820,680 (GRCm39) missense probably damaging 1.00
R7367:Nos2 UTSW 11 78,840,916 (GRCm39) missense possibly damaging 0.77
R7398:Nos2 UTSW 11 78,827,297 (GRCm39) nonsense probably null
R7411:Nos2 UTSW 11 78,835,681 (GRCm39) critical splice donor site probably null
R7469:Nos2 UTSW 11 78,843,797 (GRCm39) missense possibly damaging 0.94
R7736:Nos2 UTSW 11 78,813,192 (GRCm39) nonsense probably null
R8694:Nos2 UTSW 11 78,836,515 (GRCm39) missense possibly damaging 0.93
R8832:Nos2 UTSW 11 78,846,290 (GRCm39) splice site probably null
R8872:Nos2 UTSW 11 78,839,949 (GRCm39) missense probably damaging 0.99
R8952:Nos2 UTSW 11 78,836,089 (GRCm39) missense probably benign 0.00
R9433:Nos2 UTSW 11 78,850,490 (GRCm39) missense probably damaging 1.00
R9612:Nos2 UTSW 11 78,839,984 (GRCm39) missense probably damaging 1.00
R9727:Nos2 UTSW 11 78,843,825 (GRCm39) missense possibly damaging 0.51
R9747:Nos2 UTSW 11 78,822,472 (GRCm39) missense probably damaging 0.96
X0063:Nos2 UTSW 11 78,813,193 (GRCm39) missense probably benign 0.01
Z1177:Nos2 UTSW 11 78,822,498 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATGAGGCTTCCCAGAGTG -3'
(R):5'- TCGATGCACAACTGAGGGAG -3'

Sequencing Primer
(F):5'- CTTGATAGTTAGGGAGAAGCTGGC -3'
(R):5'- GAGAGGGGCCCAGTAAGTCTG -3'
Posted On 2022-08-09